Unexpected appearance of KMT2A::MLLT10 fusion transcript in acute myeloid leukemia with t(5;11)(q31;q23.3)

[1] Marschalek R. Mechanisms of leukemogenesis by MLL fusion proteins. Br J Haematol

2011;152:141-154.

[2] Meyer C, Bumeister T, Gröger D, Tsaur G, Fechina L, Renneville A, et al. The MLL recombinome of acute leukemiaös in 2017. Leukemia 2018;32:273-284.

[3] Mitelman F, Johansson B, Mertens F (Eds.). Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer (2022). https://mitelmandatabase.isb-cgc.org. accessed July 15, 2022.

[4] Borkhardt A, Bojesen S, Haas OA, Fuchs U, Bartelheimer D, Loncarevic IF, et al. The

human GRAF gene is fused to MLL in a unique t(5;11)(q31;q23) and both alleles are

disrupted in three cases of myelodysplastic syndrome/acute myeloid leukemia with a

- 10 -

deletion 5q. Proc Natl Acad Sci USA 2000;97:9168-9173.

[5] Panagopoulos I, Kitagawa A, Isaksson M, Mörse H, Mitelman F, Johansson B.

MLL/GRAF fusion in an infant acute monocytic leukemia (AML M5b) with a cytogenetically cryptic ins(5;11)(q31;q23q23). Genes Chromosomes Cancer 2004;41:400-404.

[6] Wilda M, Perez AV, Bruch J, Woessnann W, Metzler M, Fuchs U, et al. Use of

MLL/GRAF fusion mRNA for measurement of minimal residual disease during chemotherapy in an infant with acute monoblastic leukemia (AML-M5). Genes Chromosomes

Cancer 2005;43:424-426.

[7] Taki T, Kano H, Taniwaki M, Sako M, Yanagisawa M, Hayashi Y. AF5q31, a newly identified AF4-related gene, is fused to MLL in infant acute lymphoblastic leukemia with

ins(5;11)(q31;q13q23). Proc Natl Acad Sci USA 1999;96:14535-14540.

[8] Imamura T, Morimoto A, Ikushima S, Kakazu N, Hada S, Tabata Y, et al. A novel infant

acute lymphoblastic leukemia cell line with MLL-AF5q31 fusion transcript. Leukemia

2002;16:2302-2308.

[9] Deveney R, Chervinsky DS, Jani-Sait SN, Grossi M, Aplan PD. Insertion of MLL sequences into chromosome band 5q31 results in an MLL-AF5q31 fusion and is a rare but

recurrent abnormality associated with infant leukemia. Genes Chromosomes Cancer

2003;37:326-331.

[10] Chaplin T, Bernard O, Beverloo HB, Saha V, Hagemeijer A, Berger R, et al. The

t(10;11) translocation in acute myeloid leukemia (M5) consistently fuses the leucine

zipper motif of AF10 onto the HRX gene. Blood 1995;86:2073-2076.

[11] Van Limbergen H, Poppe B, Janssens A, De Bock R, De Paepe A, Noens L, et al. Molecular cytogenetic analysis of 10;11 rearrangements in acute myeloid leukemia. Leukemia 2002;16:344-351.

[12] Peterson JF, Sukov WR, Pitel BA, Smoley SA, Pearce KE, Meyer RG, et al. Acute leu- 11 -

kemias harboring KMT2A/MLLT10 fusion: a 10-year experience from a single genomics

laboratory. Genes Chromosomes Cancer 2019;58:567-577.

[13] Morerio C, Rapella A, Rosanda C, Lanino E, Lo Nigro L, Di Cataldo A, et al.

MLL-MLLT10 fusion in acute monoblastic leukemia: variant complex rearrangements

and 11q proximal heterogeneity. Cancer Genet Cytogenet 2004;152:108-112.

[14] Christiansen L, Allen RA, Dunn ST, Wolff DJ. A case of infantile acute myelogenous

leukemia with MLL-MLLT10 fusion caused by insertion of 11q into 10p. Cancer Genet

Cytogenet 2005;159:181-183.

[15] Jarosova M, Takacova S, Holzerova M, Priwitzerova M, Divoka M, Lakoma I, et al.

Cryptic MLL-AF10 fusion caused by insertion of duplicated 5’ part of MLL into 10p12

in acute leukemia: a case report. Cancer Genet Cytogenet 2005;162:179-182.

[16] Matsuda K, Hidaka E, Ishida F, Yamauchi K, Makishima H, Ito T, et al. A case of acute

myelogenous leukemia with MLL-AF10 fusion caused by insertion of 5’ MLL into

10p12, with concurrent 3’ MLL deletion. Cancer Genet Cytogenet 2006;171:24-30.

[17] Zerkalenkova E, Lebedeva S, Kazakova A, Tsaur G, Starichkova Y, Timofeeva N, et al.

Acute myeloid leukemia with t(10;11)(p11-12;q23.3): Results of Russian pediatric AML

registration study. Int J Lab Hematol 2019;41:287-292.

[18] Meyer C, Lopes BA, Caye-Eude A, Cavé H, Arfeuille C, Cuccuini W, et al. Human

MLL/KMT2A gene exhibits a second breakpoint cluster region for recurrent MLL-USP2

fusions. Leukemia 2019;33:2306-2310.

[19] Klaus M, Schnittger S, Haferlach T, Dreyling M, Hiddemann W, Schoch C. Cytogenetics, fluorescence in situ hybridization, and reverse transcriptase polymerase chain reaction are necessary to clarify the various mechanisms leading to an MLL-AF10 fusion in

acute myelocytic leukemia with 10;11 rearrangement. Cancer Genet Cytogenet

2003;144:36-43.

- 12 -

[20] Yokoyama A. Transcriptional activation by MLL fusion proteins in leukemogenesis.

Exp Hematol 2017;46:21-30.

[21] Bursen A, Schwabe K, Rüster B, Henschler R, Ruthardt M, Dingermann T, et al. The

AF4·MLL fusion protein is capable of inducing ALL in mice without requirement of

MLL·AF4. Blood 2010;115:3570-3579.

- 13 -

Figure legends

Fig. 1. Cytogenetic and morphological findings of leukemic cells in bone marrow.

(A) Bone marrow smear shows large-sized promonocytes with fine nuclear chromatin and

pale cytoplasm (×1000, May–Grünwald–Giemsa stain).

(B) The karyotype by G-banding is 46,XX,t(5;11)(q31;q23.3). Two arrows indicate

der(5)t(5;11) and der(11)t(5;11).

(C) Spectral karyotyping (SKY) of metaphase spreads (right, SKY; left, reverse DAPI).

Chromosomes 5, 11, and 10 are presented. Both der(5)t(5;11)(q31;q23.3) and

der(11)t(5;11)(q31;q23.3) were found. No apparent abnormality was found on chromosomes 10. DAPI, 4,6-diamidino-2-phenylindole

(D) Fluorescence in situ hybridization (FISH) on metaphase cells using a Vysis LSI MLL

Dual Color, Break Apart Rearrangement Probe. The arrows point to 1) a faint 5’ KMT2A

signal (green) on chromosome 10, 2) a normal 5’ KMT2A/3’ KMT2A fusion signal (yellow) on a normal chromosome 11, 3) a 5’ KMT2A signal (green) on der(11)t(5;11), and

4) a 3’ KMT2A signal (red) on der(5)t(5;11).

(E) FISH on interphase nuclei using the same probe. Red, green, and yellow signals were

found on an interphase nucleus. In addition, a faint green signal (arrow) was detected.

(F) Schematic presentation of the KMT2A gene and putative breakpoints in the 11q23 region.

The position of a Vysis LSI MLL probe (5’ KMT2A and 3’ KMT2A probes) covering the

KMT2A gene on a normal chromosome 11 is presented. Two vertical arrows indicate

assumed breakpoints; that is, the 5’ side of KMT2A exon 1 and 3’ side of KMT2A exon 6.

An 11q23 fragment containing KMT2A exons 1 to 6 may be inserted into MLLT10 at

10p12, resulting in der(10)ins(10)(p12q23q23).

Fig. 2. RT–PCR and sequence analyses of leukemic cells in the bone marrow.

- 14 -

(A) Expression of KMT2A::MLLT10::AFF4 chimeric transcripts by reverse transcription

polymerase chain reaction (RT–PCR) using KMT-e6 and AFF-e10 primers. Lane M,

100-bp DNA size markers; lane 1, leukemic cells from the patient. An amplified band of

430 bp was detected.

(B) A KMT2A::MLLT10::AFF4 fusion transcript is shown schematically. White, gray, and

small white boxes correspond to KMT2A, MLLT10, and AFF4 exons, respectively. Horizontal arrows indicate the positions of KMT-e6 and AFF-e10 primers. The numbers of

nucleotides and exons originate from National Center for Biotechnology Information

(NCBI) reference sequences.

(C) Nucleotide sequences of the PCR product, MLLT10 exon 18, AFF4 exon 10, and AFF4

antisense primer (AFF-e10) were compared. Eight nucleotides (AAGCAGCT) were

identical between MLLT10 exon 18 and AFF4 exon 10. Thus, the AFF4 antisense primer

probably cross-hybridized with MLLT10 exon 18.

(D) Expression of KMT2A::MLLT10 chimeric transcripts by RT–PCR using KMT-e5 and

MLL-e15 primers. Lane M, size markers (100-bp DNA ladder); lane 1, leukemic cells

from the patient; and lane 2, negative control (normal bone marrow mononuclear cells).

An amplified band of 363 bp was detected in the patient’s cells.

(E) A KMT2A::MLLT10 fusion transcript is shown schematically. White and gray boxes

correspond to KMT2A and MLLT10 exons, respectively. Horizontal arrows indicate the

positions of KMT-e5 and MLL-e15 primers. The number of nucleotides and exons originate from the NCBI reference sequences.

(F) Amino acid and nucleotide sequences around the breakpoint of the KMT2A::MLLT10

chimeric transcript. KMT2A exon 6 and MLLT10 exon 15 are connected in-frame. The

breakpoint is indicated by a vertical arrow.

- 15 -

Fig. 3. Schematic presentation of the partial karyotype of chromosomes 5, 10, and 11 including normal chromosomes (left) and derivative chromosomes (right).

Idiograms of G-banding patterns for t(5;11)(q31;q23.3) and ins(10;11)(p12q23q23) at

300-band levels are shown. Chromosomal breakpoints are indicated by horizontal arrows.

The location of the related genes (AFF4, ARHGAP26, KMT2A, and MLLT10) are shown on

the normal chromosomes. 5’ KMT2A (green) and 3’ KMT2A (red) signals on normal and derivative chromosomes are also shown.

- 16 -

Fig. 1

(C)

(F)

Fig. 2

500 bp-

-430 bp

100 bp-

C TCTCGCCACGATCCCCTGTAAGCAGCTTACAGATTCGCT

:::::::::::::::::::::::::::

: ::

TCTCGCCACGATCCCCTGTAAGCAGCTCTGGATCTGACT

::: ::::::::::::::::::::

GTAGCCACAGTGGATCTGAAAGCAGCTCTGGATCTGACT

3’-CTTTCGTCGAGACCTAGACTGA-5’

MLLT10

PCR product

AFF4

AFF-e10

antisense primer

500 bp-363 bp

100 bp-

breakpoint

KMT2A exon 6

MLLT10 exon 15

Fig. 3

der(10)ins(10;11)

der(5)t(5;11)

der(11)t(5;11)

p12

MLLT10

q31

AFF4

ARHGAP26

chromosome 5

3’KMT2A

chromosome 10

5’KMT2A

ex1-ex6

q23.3

5’KMT2A

KMT2A

3’KMT2A

chromosome 11

5’KMT2A

...