論文の公開元へ

書き出し

Refer/BibIX

RIS

BibTeX

TSV

Arabinogalactan protein polysaccharide chains are required for normal biogenesis of plasmodesmata

Okawa, Ryoya Hayashi, Yoko Yamashita, Yasuko Matsubayashi, Yoshikatsu Ogawa‐Ohnishi, Mari 名古屋大学

2023.02

概要

Arabinogalactan proteins (AGPs) are plant-specific extracellular proteoglycans
found widely throughout the plant kingdom, from the green alga Chlamydomonas to
higher plants (Ma et al., 2017). AGPs are characterized by a high proportion of
carbohydrate moieties, which represents more than 90% of the total molecular mass and
are thought to be critical for molecular function (Ellis et al., 2010). To date, a total of
151, 282, and 313 putative AGPs have been identified in the model plants Arabidopsis
thaliana, Oryza sativa, and Glycine max, respectively. In Arabidopsis, 151 AGPs are
further classified into five classes based on the similarities in their core protein
structures: 23 classical AGPs; 16 arabinogalactan (AG) peptides; three Lys-rich AGPs;
four hybrid AGPs; and 105 chimeric AGPs (Ma et al., 2017). AGPs are ubiquitous in all
plant organs and thought to perform various functions in each organ (Showalter, 2001,
Ellis et al., 2010, Su and Higashiyama, 2018, Leszczuk et al., 2020, Hromadova et al.,
2021). To date, however, fewer than 30 AGPs in Arabidopsis have been functionally
characterized, including SOS5/FLA4 (Shi et al., 2003, Griffiths et al., 2014, Seifert et
al., 2014, Basu et al., 2016, Seifert, 2021), FLA11, FLA12 (MacMillan et al., 2010, Ma
et al., 2022) and AGP18 (Acosta-Garcia and Vielle-Calzada, 2004, Demesa-Arevalo
and Vielle-Calzada, 2013). The available results suggest that AGPs play a range of
physiological roles in processes such as reproduction, cell proliferation, pattern
formation, growth, and plant-microbe interactions (Gaspar et al., 2004, Nguema-Ona et
al., 2007, Nguema-Ona et al., 2013, Pereira et al., 2016, Su and Higashiyama, 2018).
However, the high level of genetic and functional redundancy of AGP genes has
hindered the elucidation of their specific roles.
Yariv phenylglycosides are often used as cytochemical reagents to perturb the
molecular functions of AGPs (Yariv et al., 1962). Yariv reagents selectively and
non-covalently bind to the β-1,3-galactan moiety of AGPs, acting as specific functional
inhibitors (Kitazawa et al., 2013). Yariv treatment caused the arrest of pollen tube
growth (Mollet, 2002), root hair elongation (Marzec et al., 2015), and root growth,
accompanied by microtubule disorganization (Nguema-Ona et al., 2007). However,
because Yariv reagents are unable to penetrate the plasma membrane, their targets are
limited to tissue surface AGPs.
Carbohydrate-degrading enzymes of AGPs are also useful tools for functional
analyses of the sugar moieties of AGPs. Transgenic Arabidopsis plants expressing a
fungal exo-β-1,3-galactanase that specifically hydrolyzes the β-1,3-galactan backbone
of type II AGs showed severe tissue disorganization in the hypocotyl and cotyledons,
accompanied by a decrease in Yariv reagent reactive AGPs (Yoshimi et al., 2020). ...

論文の公開元へ

参考文献

Acosta-Garciéa, G. and Vielle-Calzada, J.P. (2004) A classical arabinogalactan

protein is essential for the initiation of female gametogenesis in Arabidopsis.

Plant Cell, 16, 2614-2628. https://doi.org/10.1105/tpc.104.024588

Basu, D., Liang, Y., Liu, X., Himmeldirk, K., Faik, A., Kieliszewski, M., Held, M.

and Showalter, A.M. (2013) Functional identification of a

hydroxyproline-O-galactosyltransferase specific for arabinogalactan protein

biosynthesis in Arabidopsis. J Biol Chem, 288, 10132-10143.

https://doi.org/10.1074/jbc.M112.432609

Basu, D., Tian, L., Debrosse, T., Poirier, E., Emch, K., Herock, H., Travers, A. and

Showalter, A.M. (2016) Glycosylation of a Fasciclin-like

arabinogalactan-protein (SOS5) mediates root growth and seed mucilage

adherence via a cell wall receptor-like kinase (FEI1/FEI2) Pathway in

Arabidopsis. PLoS One, 11, e0145092.

https://doi.org/10.1371/journal.pone.0145092

Basu, D., Wang, W., Ma, S., DeBrosse, T., Poirier, E., Emch, K., Soukup, E., Tian,

L. and Showalter, A.M. (2015) Two hydroxyproline galactosyltransferases,

GALT5 and GALT2, function in arabinogalactan-protein glycosylation, growth

and development in Arabidopsis. PLoS One, 10, e0125624.

https://doi.org/10.1371/journal.pone.0125624

Burch-Smith, T.M. and Zambryski, P.C. (2010) Loss of INCREASED SIZE

EXCLUSION LIMIT (ISE)1 or ISE2 increases the formation of secondary

plasmodesmata. Curr Biol, 20, 989-993.

https://doi.org/10.1016/j.cub.2010.03.064

Deinum, E.E., Mulder, B.M. and Benitez-Alfonso, Y. (2019) From plasmodesma

geometry to effective symplasmic permeability through biophysical modelling.

Elife, 8. https://doi.org/10.7554/eLife.49000

Demesa-Arevalo, E. and Vielle-Calzada, J.P. (2013) The classical arabinogalactan

protein AGP18 mediates megaspore selection in Arabidopsis. Plant Cell, 25,

1274-1287. https://doi.org/10.1105/tpc.112.106237

Dilokpimol, A., Poulsen, C.P., Vereb, G., Kaneko, S., Schulz, A. and Geshi, N.

(2014) Galactosyltransferases from Arabidopsis thaliana in the biosynthesis of

type II arabinogalactan: molecular interaction enhances enzyme activity. BMC

Plant Biol, 14, 90. https://doi.org/10.1186/1471-2229-14-90

Ehlers, K. and Kollmann, R. (2001) Primary and secondary plasmodesmata: structure,

origin, and functioning. Protoplasma, 216, 1-30.

https://doi.org/10.1007/BF02680127

Ellis, M., Egelund, J., Schultz, C.J. and Bacic, A. (2010) Arabinogalactan-proteins:

key regulators at the cell surface? Plant Physiol, 153, 403-419.

https://doi.org/10.1104/pp.110.156000

Faulkner, C., Akman, O.E., Bell, K., Jeffree, C. and Oparka, K. (2008) Peeking into

pit fields: a multiple twinning model of secondary plasmodesmata formation in

tobacco. Plant Cell, 20, 1504-1518. https://doi.org/10.1105/tpc.107.056903

Gaspar, Y.M., Nam, J., Schultz, C.J., Lee, L.Y., Gilson, P.R., Gelvin, S.B. and

Bacic, A. (2004) Characterization of the Arabidopsis lysine-rich

arabinogalactan-protein AtAGP17 mutant (rat1) that results in a decreased

efficiency of agrobacterium transformation. Plant Physiol, 135, 2162-2171.

https://doi.org/10.1104/pp.104.045542

Geshi, N., Johansen, J.N., Dilokpimol, A., Rolland, A., Belcram, K., Verger, S.,

Kotake, T., Tsumuraya, Y., Kaneko, S., Tryfona, T., Dupree, P., Scheller,

H.V., Hofte, H. and Mouille, G. (2013) A galactosyltransferase acting on

arabinogalactan protein glycans is essential for embryo development in

Arabidopsis. Plant J, 76, 128-137. https://doi.org/10.1111/tpj.12281

Griffiths, J.S., Tsai, A.Y., Xue, H., Voiniciuc, C., Šola, K., Seifert, G.J., Mansfield,

S.D. and Haughn, G.W. (2014) SALT-OVERLY SENSITIVE5 mediates

Arabidopsis seed coat mucilage adherence and organization through Pectins.

Plant Physiol, 165, 991-1004. https://doi.org/10.1104/pp.114.239400

Guseman, J.M., Lee, J.S., Bogenschutz, N.L., Peterson, K.M., Virata, R.E., Xie, B.,

Kanaoka, M.M., Hong, Z. and Torii, K.U. (2010) Dysregulation of cell-to-cell

connectivity and stomatal patterning by loss-of-function mutation in Arabidopsis

CHORUS (GLUCAN SYNTHASE-LIKE 8). Development, 137, 1731-1741.

https://doi.org/10.1242/dev.049197

Han, S.K. and Torii, K.U. (2016) Lineage-specific stem cells, signals and asymmetries

during stomatal development. Development, 143, 1259-1270.

https://doi.org/10.1242/dev.127712

Haque, A., Kotake, T. and Tsumuraya, Y. (2005) Mode of action of

beta-glucuronidase from Aspergillus niger on the sugar chains of

arabinogalactan-protein. Biosci Biotechnol Biochem, 69, 2170-2177.

https://doi.org/10.1271/bbb.69.2170

Hromadová, D., Soukup, A. and Tylová, E. (2021) Arabinogalactan proteins in plant

roots - An update on possible functions. Front Plant Sci, 12, 674010.

https://doi.org/10.3389/fpls.2021.674010

Kaur, D., Held, M.A., Smith, M.R. and Showalter, A.M. (2021) Functional

characterization of hydroxyproline-O-galactosyltransferases for Arabidopsis

arabinogalactan-protein synthesis. Bmc Plant Biol, 21, 590.

https://doi.org/10.1186/s12870-021-03362-2

Kitazawa, K., Tryfona, T., Yoshimi, Y., Hayashi, Y., Kawauchi, S., Antonov, L.,

Tanaka, H., Takahashi, T., Kaneko, S., Dupree, P., Tsumuraya, Y. and

Kotake, T. (2013) beta-galactosyl Yariv reagent binds to the beta-1,3-galactan

of arabinogalactan proteins. Plant Physiol, 161, 1117-1126.

https://doi.org/10.1104/pp.112.211722

Knoch, E., Dilokpimol, A. and Geshi, N. (2014) Arabinogalactan proteins: focus on

carbohydrate active enzymes. Front Plant Sci, 5, 198.

https://doi.org/10.3389/fpls.2014.00198

Knoch, E., Dilokpimol, A., Tryfona, T., Poulsen, C.P., Xiong, G., Harholt, J.,

Petersen, B.L., Ulvskov, P., Hadi, M.Z., Kotake, T., Tsumuraya, Y., Pauly,

M., Dupree, P. and Geshi, N. (2013) A beta-glucuronosyltransferase from

Arabidopsis thaliana involved in biosynthesis of type II arabinogalactan has a

role in cell elongation during seedling growth. Plant J, 76, 1016-1029.

https://doi.org/10.1111/tpj.12353

Knox, J.P. and Benitez-Alfonso, Y. (2014) Roles and regulation of plant cell walls

surrounding plasmodesmata. Curr Opin Plant Biol, 22, 93-100.

https://doi.org/10.1016/j.pbi.2014.09.009

Kobayashi, K., Otegui, M.S., Krishnakumar, S., Mindrinos, M. and Zambryski, P.

(2007) INCREASED SIZE EXCLUSION LIMIT 2 encodes a putative DEVH box

RNA helicase involved in plasmodesmata function during Arabidopsis

embryogenesis. Plant Cell, 19, 1885-1897.

https://doi.org/10.1105/tpc.106.045666

Kong, D., Karve, R., Willet, A., Chen, M.K., Oden, J. and Shpak, E.D. (2012)

Regulation of plasmodesmatal permeability and stomatal patterning by the

glycosyltransferase-like protein KOBITO1. Plant Physiol, 159, 156-168.

https://doi.org/10.1104/pp.112.194563

Leszczuk, A., Kalaitzis, P., Blazakis, K.N. and Zdunek, A. (2020) The role of

arabinogalactan proteins (AGPs) in fruit ripening-a review. Hortic Res, 7, 176.

https://doi.org/10.1038/s41438-020-00397-8

Li, J., Yu, M., Geng, L.L. and Zhao, J. (2010) The fasciclin-like arabinogalactan

protein gene, FLA3, is involved in microspore development of Arabidopsis.

Plant J, 64, 482-497. https://doi.org/10.1111/j.1365-313X.2010.04344.x

Ma, Y., MacMillan, C.P., de Vries, L., Mansfield, S.D., Hao, P., Ratcliffe, J., Bacic,

A. and Johnson, K.L. (2022) FLA11 and FLA12 glycoproteins fine-tune stem

secondary wall properties in response to mechanical stresses. New Phytol, 233,

1750-1767. https://doi.org/10.1111/nph.17898

Ma, Y., Yan, C., Li, H., Wu, W., Liu, Y., Wang, Y., Chen, Q. and Ma, H. (2017)

Bioinformatics prediction and evolution analysis of arabinogalactan proteins in

the plant kingdom. Front Plant Sci, 8, 66.

https://doi.org/10.3389/fpls.2017.00066

MacAlister, C.A., Ohashi-Ito, K. and Bergmann, D.C. (2007) Transcription factor

control of asymmetric cell divisions that establish the stomatal lineage. Nature,

445, 537-540. https://doi.org/10.1038/nature05491

MacMillan, C.P., Mansfield, S.D., Stachurski, Z.H., Evans, R. and Southerton, S.G.

(2010) Fasciclin-like arabinogalactan proteins: specialization for stem

biomechanics and cell wall architecture in Arabidopsis and Eucalyptus. Plant J,

62, 689-703. https://doi.org/10.1111/j.1365-313X.2010.04181.x

Marga, F., Gallo, A. and Hasenstein, K.H. (2003) Cell wall components affect

mechanical properties: studies with thistle flowers. Plant Physiol Biochem, 41,

792-797. https://doi.org/10.1016/S0981-9428(03)00120-7

Marzec, M., Szarejko, I. and Melzer, M. (2015) Arabinogalactan proteins are

involved in root hair development in barley. J. Exp. Bot., 66, 1245-1257.

https://doi.org/10.1093/jxb/eru475

Mollet, J., Kim, S., Jauh, GY. et al. (2002) Arabinogalactan proteins, pollen tube

growth, and the reversible effects of Yariv phenylglycoside. Protoplasma, 219,

89-98. https://doi.org/10.1007/s007090200009

Morvan, O., Quentin, M., Jauneau, A., Mareck, A. and Morvan, C. (1998)

Immunogold localization of pectin methylesterases in the cortical tissues of flax

hypocotyl. Protoplasma, 202, 175-184. https://doi.org/10.1007/BF01282545

Nguema-Ona, E., Bannigan, A., Chevalier, L., Baskin, T.I. and Driouich, A. (2007)

Disruption of arabinogalactan proteins disorganizes cortical microtubules in the

root of Arabidopsis thaliana. Plant J, 52, 240-251.

https://doi.org/10.1111/j.1365-313X.2007.03224.x

Nguema-Ona, E., Vicre-Gibouin, M., Cannesan, M.A. and Driouich, A. (2013)

Arabinogalactan proteins in root-microbe interactions. Trends Plant Sci, 18,

440-449. https://doi.org/10.1016/j.tplants.2013.03.006

Nibbering, P., Castilleux, R., Wingsle, G. and Niittylä, T. (2022) CAGEs are

Golgi-localized GT31 enzymes involved in cellulose biosynthesis in

Arabidopsis. Plant J, 110, 1271-1285. https://doi.org/10.1111/tpj.15734

Ogawa-Ohnishi, M. and Matsubayashi, Y. (2015) Identification of three potent

hydroxyproline O-galactosyltransferases in Arabidopsis. Plant J, 81, 736-746.

https://doi.org/10.1111/tpj.12764

Oparka, K.J., Roberts, A.G., Boevink, P., Santa Cruz, S., Roberts, L., Pradel, K.S.,

Imlau, A., Kotlizky, G., Sauer, N. and Epel, B. (1999) Simple, but not

branched, plasmodesmata allow the nonspecific trafficking of proteins in

developing tobacco leaves. Cell, 97, 743-754.

https://doi.org/10.1016/S0092-8674(00)80786-2

Pagant, S., Bichet, A., Sugimoto, K., Lerouxel, O., Desprez, T., McCann, M.,

Lerouge, P., Vernhettes, S. and Höfte, H. (2002) KOBITO1 encodes a novel

plasma membrane protein necessary for normal synthesis of cellulose during cell

expansion in Arabidopsis. Plant Cell, 14, 2001-2013.

https://doi.org/10.1105/tpc.002873

Peaucelle, A., Braybrook, S.A., Le Guillou, L., Bron, E., Kuhlemeier, C. and Höfte,

H. (2011) Pectin-induced changes in cell wall mechanics underlie organ

initiation in Arabidopsis. Curr Biol, 21, 1720-1726.

https://doi.org/10.1016/j.cub.2011.08.057

Pereira, A.M., Lopes, A.L. and Coimbra, S. (2016) Arabinogalactan proteins as

interactors along the crosstalk between the pollen tube and the female tissues.

Front Plant Sci, 7, 1895. https://doi.org/10.3389/fpls.2016.01895

Phyo, P., Wang, T., Kiemle, S.N., O'Neill, H., Pingali, S.V., Hong, M. and Cosgrove,

D.J. (2017) Gradients in wall mechanics and polysaccharides along growing

inflorescence stems. Plant Physiol, 175, 1593-1607.

https://doi.org/10.1104/pp.17.01270

Qi, J., Wu, B., Feng, S., Lü, S., Guan, C., Zhang, X., Qiu, D., Hu, Y., Zhou, Y., Li,

C., Long, M. and Jiao, Y. (2017) Mechanical regulation of organ asymmetry in

leaves. Nat Plants, 3, 724-733. 10.1038/s41477-017-0008-6

Roberts, A.G. and Oparka, K.J. (2003) Plasmodesmata and the control of symplastic

transport. Plant Cell Environ, 26, 103-124.

https://doi.org/10.1046/j.1365-3040.2003.00950.x

Sardar, H.S., Yang, J. and Showalter, A.M. (2006) Molecular interactions of

arabinogalactan proteins with cortical microtubules and F-actin in Bright

Yellow-2 tobacco cultured cells. Plant Physiol, 142, 1469-1479.

https://doi.org/10.1104/pp.106.088716

Seifert, G.J. (2021) The FLA4-FEI pathway: A unique and mysterious signaling

module related to cell wall structure and stress signaling. Genes (Basel), 12.

https://doi.org/10.3390/genes12020145

Seifert, G.J. and Roberts, K. (2007) The biology of arabinogalactan proteins. Annu

Rev Plant Biol, 58, 137-161.

https://doi.org/10.1146/annurev.arplant.58.032806.103801

Seifert, G.J., Xue, H. and Acet, T. (2014) The Arabidopsis thaliana FASCICLIN LIKE

ARABINOGALACTAN PROTEIN 4 gene acts synergistically with abscisic acid

signalling to control root growth. Ann Bot, 114, 1125-1133.

https://doi.org/10.1093/aob/mcu010

Shi, H., Kim, Y., Guo, Y., Stevenson, B. and Zhu, J.K. (2003) The Arabidopsis SOS5

locus encodes a putative cell surface adhesion protein and is required for normal

cell expansion. Plant Cell, 15, 19-32. https://doi.org/10.1105/tpc.007872

Shibaya, T. and Sugawara, Y. (2009) Induction of multinucleation by beta-glucosyl

Yariv reagent in regenerated cells from Marchantia polymorpha protoplasts and

involvement of arabinogalactan proteins in cell plate formation. Planta, 230,

581-588. https://doi.org/10.1007/s00425-009-0954-y

Showalter, A.M. (2001) Arabinogalactan-proteins: structure, expression and function.

Cell Mol Life Sci, 58, 1399-1417. https://doi.org/10.1007/PL00000784

Showalter, A.M. and Basu, D. (2016) Glycosylation of arabinogalactan-proteins

essential for development in Arabidopsis. Commun Integr Biol, 9, e1177687.

https://doi.org/10.1080/19420889.2016.1177687

Stonebloom, S., Burch-Smith, T., Kim, I., Meinke, D., Mindrinos, M. and

Zambryski, P. (2009) Loss of the plant DEAD-box protein ISE1 leads to

defective mitochondria and increased cell-to-cell transport via plasmodesmata.

Proc Natl Acad Sci U S A, 106, 17229-17234.

https://doi.org/10.1073/pnas.09092291

Su, S. and Higashiyama, T. (2018) Arabinogalactan proteins and their sugar chains:

functions in plant reproduction, research methods, and biosynthesis. Plant

Reprod, 31, 67-75. https://doi.org/10.1007/s00497-018-0329-2

Tan, L., Eberhard, S., Pattathil, S., Warder, C., Glushka, J., Yuan, C., Hao, Z.,

Zhu, X., Avci, U., Miller, J.S., Baldwin, D., Pham, C., Orlando, R., Darvill,

A., Hahn, M.G., Kieliszewski, M.J. and Mohnen, D. (2013) An Arabidopsis

cell wall proteoglycan consists of pectin and arabinoxylan covalently linked to

an arabinogalactan protein. Plant Cell, 25, 270-287.

https://doi.org/10.1105/tpc.112.107334

Tan, L., Varnai, P., Lamport, D.T., Yuan, C., Xu, J., Qiu, F. and Kieliszewski, M.J.

(2010) Plant O-hydroxyproline arabinogalactans are composed of repeating

trigalactosyl subunits with short bifurcated side chains. J Biol Chem, 285,

24575-24583. https://doi.org/10.1074/jbc.M109.100149

Tryfona, T., Liang, H.C., Kotake, T., Kaneko, S., Marsh, J., Ichinose, H.,

Lovegrove, A., Tsumuraya, Y., Shewry, P.R., Stephens, E. and Dupree, P.

(2010) Carbohydrate structural analysis of wheat flour arabinogalactan protein.

Carbohydr Res, 345, 2648-2656. https://doi.org/10.1016/j.carres.2010.09.018

Tryfona, T., Liang, H.C., Kotake, T., Tsumuraya, Y., Stephens, E. and Dupree, P.

(2012) Structural characterization of Arabidopsis leaf arabinogalactan

polysaccharides. Plant Physiol, 160, 653-666.

https://doi.org/10.1104/pp.112.202309

Wang, X., Jing, Y., Zhang, B., Zhou, Y. and Lin, R. (2015) Glycosyltransferase-like

protein ABI8/ELD1/KOB1 promotes Arabidopsis hypocotyl elongation through

regulating cellulose biosynthesis. Plant Cell Environ, 38, 411-422.

https://doi.org/10.1111/pce.12395

Wolf, S. and Greiner, S. (2012) Growth control by cell wall pectins. Protoplasma, 249

Suppl 2, S169-175. https://doi.org/10.1007/s00709-011-0371-5

Wu, S.W., Kumar, R., Iswanto, A.B.B. and Kim, J.Y. (2018) Callose balancing at

plasmodesmata. J Exp Bot, 69, 5325-5339. https://doi.org/10.1093/jxb/ery317

Xu, M., Cho, E., Burch-Smith, T.M. and Zambryski, P.C. (2012) Plasmodesmata

formation and cell-to-cell transport are reduced in decreased size exclusion limit

1 during embryogenesis in Arabidopsis. Proc Natl Acad Sci U S A, 109,

5098-5103. https://doi.org/10.1073/pnas.1202919109

Yan, R., Han, C., Fu, M., Jiao, W. and Wang, W. (2022) Inhibitory effects of CaCl2

and pectin methylesterase on fruit softening of Raspberry during cold storage.

Horticulturae, 8. https://doi.org/10.3390/horticulturae8010001

Yariv, J., Rapport, M.M. and Graf, L. (1962) The interaction of glycosides and

saccharides with antibody to the corresponding phenylazo glycosides. Biochem J,

85, 383-388. https://doi.org/10.1042/bj0850383

Yoshimi, Y., Hara, K., Yoshimura, M., Tanaka, N., Higaki, T., Tsumuraya, Y. and

Kotake, T. (2020) Expression of a fungal exo-beta-1,3-galactanase in

Arabidopsis reveals a role of type II arabinogalactans in the regulation of cell

shape. J Exp Bot, 71, 5414-5424. https://doi.org/10.1093/jxb/eraa236

Yu, M. and Zhao, J. (2012) The cytological changes of tobacco zygote and proembryo

cells induced by beta-glucosyl Yariv reagent suggest the involvement of

arabinogalactan proteins in cell division and cell plate formation. Bmc Plant Biol,

12, 126. https://doi.org/10.1186/1471-2229-12-126

Zhang, Y., Held, M.A., Kaur, D. and Showalter, A.M. (2021) CRISPR-Cas9

multiplex genome editing of the hydroxyproline-O-galactosyltransferase gene

family alters arabinogalactan-protein glycosylation and function in Arabidopsis.

Bmc Plant Biol, 21, 16. https://doi.org/10.1186/s12870-020-02791-9

Fig. 1. The hpgt1,2,3 triple mutant exhibits a stomatal patterning defect. (a)

Differential interference contrast images are shown of the abaxial cotyledon epidermis

from 12-day-old seedlings. The white arrowheads indicated clustered stomata. Scale bar,

50 µm. (b) Quantification of clustered stomata on the abaxial epidermis of 12-day-old

cotyledons in the wild-type, hpgt1,2,3 triple mutant, and mutant complemented with

HPGTs (mean ± SEM, p < 0.05, one-way ANOVA followed by Tukey's test, n = 70). (c)

Percentage of stomata in each cluster size class. Abaxial cotyledons from 12-day-old

seedlings of the wild-type, hpgt1,2,3 triple mutant, and mutant complemented with

HPGTs (mean ± SEM, n = 70). HPGT, Hyp O-galactosyltransferase.

Fig. 2. The hpgt1,2,3 triple mutant exhibits increased plasmodesmata conductivity.

(a) Representative images of the epidermis of cotyledons of 7-day-old seedlings

expressing co-bombarded endoplasmic reticulum (ER) localized monomeric red

fluorescent protein (mRFP; top), sGFP (S65T; middle), and both merged (bottom).

Cells with a less-intense GFP signal are labeled with asterisks. Scale bar: 100 µm. (b)

Quantitative distribution analysis of the number of cells expressing GFP per site (n =

50-54).

Fig. 3. Plasmodesmata density does not change in the hpgt1,2,3 triple mutant. (a)

Aniline blue staining of plasmodesmal callose in the wild-type and hpgt1,2,3 triple

mutant. Scale bar: 50 µm. (b) Density of callose deposits by aniline blue staining in the

wild-type and hpgt1,2,3 triple mutant (mean ± SD, p < 0.05, Student's t-test, n = 20-22).

expressing plasmodesmata-located protein 1 (PDLP1)-green fluorescent protein (GFP).

Scale bar: 50 µm. (d) Density of PDLP1-GFP dots in the wild-type and hpgt1,2,3 triple

mutant (mean ± SD, p < 0.05, Student's t-test, n = 34-38).

Fig. 4. The hpgt1,2,3 triple mutant exhibits increased plasmodesmata with highly

complex structures. (a) Classification of plasmodesmata structures. (b) Transmission

electron microscope (TEM) images. Classification of plasmodesmata in cotyledons of

7-day-old wild-type: simple, H-shaped, complex branched, and large cavity (from left to

right). Scale bar: 200 nm. (c) TEM images. Classification of plasmodesmata in

cotyledons of 7-day-old hpgt1,2,3 triple mutants: simple, H-shaped, complex branched,

and large cavity (from left to right). (d) Fractions of classified structures of

plasmodesmata in the wild-type and hpgt1,2,3 triple mutant (n = 90-97).

Fig. 5. The hpgt1,2,3 triple mutant exhibits altered cell wall carbohydrate

composition. (a) Comparison of alcohol-insolube residue (AIR) content in 8-day-old

cotyledons of the wild-type and hpgt1,2,3 triple mutant (mean ± SD, p < 0.05, Student's

t-test, n = 3). (b) Quantitative comparison of total sugar content in fractions after

sequential extraction of AIR from 7-day-old cotyledons of wild-type and hpgt1,2,3

triple mutants (mean ± SD, *p < 0.05, two-way ANOVA followed by Sidak's multiple

comparison test, n = 3). (c) Quantitative comparison of cell wall monosaccharide

composition of 7-day-old cotyledons of the wild-type and hpgt1,2,3 triple mutant (mean

± SD, *p < 0.05, two-way ANOVA followed by Sidak's multiple comparison test, n = 3).

(d) Quantitative comparison of calcium (Ca) content of 7-day-old cotyledon AIR in the

wild-type and hpgt1,2,3 triple mutant (mean ± SD, *p < 0.05, Student's t-test, n = 3).

Forward primer sequence (5'-3')

GCAGGTCGACTCTAGGAACACCTTCTCCTGATACATCTCTGC

GCAGGTCGACTCTAGCGTTATCTCCAAGTTTTGGGGTTTG

GCAGGTCGACTCTAGGATCGGCCTGCAATAGGCATC

CTCTAGAGGATCCCCATGAAGACTAATCTTTTTCT

CACGGGGGACTCTAGGATCCCCCGGGCTGCAG

GCAGGTCGACTCTAGTCTTCCAGAGAGCTAATAGC

GGGCTGCAGGAATTCGATCCCATG

Experiment

HPGT1 complementation

HPGT2 complementation

HPGT3 complementation

proCaMV35S::mRFP-HDEL

proCaMV35S::sGFP

PDLP1a for pIG-35S:PDLP1a-GFP:NOS

GFP for pIG-35S:PDLP1a-GFP:NOS

Supplementary Table 1. Primer sequences used in this study.

GATCGGGGAAATTCGCGCTTTACTTGTACAGCTCGTC

GAATTCCTGCAGCCCATAAGCATCATATTTATTAC

GATCGGGGAAATTCGCGCTTTACTTGTACAGCTCGTC

ATTCGAGCTCGGTACCCTCAAAGCTCATCGTGGTG

GATCGGGGAAATTCGCGCTATGAATATACGAGTG

GATCGGGGAAATTCGCATAAACTGTAATGAATGG

GATCGGGGAAATTCGGTAATTAGCTTTCTTCAGAC

Reverse primer sequence (5'-3')

pIG121Hm

pUC-35S:NOS

pIG121Hm

Vector

Xba I, Sac I

Sma I

Xba I, Sac I

Restriction site

In-fusion

Assembly

In-fusion

Note

...

参考文献をもっと見る

分野

大学

学位論文種類・取得年

言語

Arabinogalactan protein polysaccharide chains are required for normal biogenesis of plasmodesmata

概要

関連論文

Exploring the biosynthesis and physiological function of gibberellin-related compounds in the liverwort Marchantia polymorpha

Comprehensive analysis of the phosphoproteome dynamics responsible for carbon/nitrogen-nutrient availability and identification of a cell death related receptor-like kinase in Arabidopsis

Coregulation of glutamine synthetase1;2 (GLN1;2) and NADH-dependent glutamate synthase (GLT1) gene expression in Arabidopsis roots in response to ammonium supply

Networking and Specificity-Changing DNA Methyltransferases in Helicobacter pylori.

Studies on histone chaperones and protein kinases involved in nutrient-responsive growth regulation in Arabidopsis thaliana [an abstract of entire text]

参考文献

分野

大学

学位論文種類・取得年

言語

コピーが完了しました

URLをコピーしました

Arabinogalactan protein polysaccharide chains are required for normal biogenesis of plasmodesmata

概要

関連論文

Exploring the biosynthesis and physiological function of gibberellin-related compounds in the liverwort Marchantia polymorpha

Comprehensive analysis of the phosphoproteome dynamics responsible for carbon/nitrogen-nutrient availability and identification of a cell death related receptor-like kinase in Arabidopsis

Coregulation of glutamine synthetase1;2 (GLN1;2) and NADH-dependent glutamate synthase (GLT1) gene expression in Arabidopsis roots in response to ammonium supply

Networking and Specificity-Changing DNA Methyltransferases in Helicobacter pylori.

Studies on histone chaperones and protein kinases involved in nutrient-responsive growth regulation in Arabidopsis thaliana [an abstract of entire text]

参考文献