SP600125 Enhances Temperature-Controlled Repeated Thermal Stimulation-Induced Neurite Outgrowth in PC12-P1F1 Cells

[1]. Teng, K.K.; Georgieff, I.S.; Nunez, J.; Shelanski, M.L.; Greene, L.A. Characterization of

a PC12 cell sub-clone (PC12-C41) with enhanced neurite outgrowth with capacity:

Implications for a modulatory role of high molecular weight tau in neuritogenesis. J. Cell

Sci. 1993, 106, 611–626. https://doi.org/10.1242/jcs.106.2.611.

[2]. Gokoffski, K.K.; Peng, M.; Alas, B.; Lam, P. Neuro-protection and neuro-regeneration of

the optic nerve: Recent advances and future directions. Curr. Opin. Neurol. 2020, 33, 93–

105. https://doi.org/10.1097/WCO.0000000000000777.

[3]. Higgins, S.; Lee, J.S.; Ha, L.; Lim, J.Y. Inducing neurite outgrowth by mechanical cell

stretch. Biores. Open Access 2013, 2, 212–216. https://doi.org/10.1089/biores.2013.0008.

[4]. Kudo, T.; Kanetaka, H.; Mochizuki, K.; Tominami, K. Induction of neurite outgrowth in

PC12 cells treated with temperature-controlled repeated thermal stimulation. PLoS ONE

2015, 10, e0124024. https://doi.org/10.1371/journal.pone.0124024.

[5]. Wiatrak, B.; Kubis-Kubiak, A.; Piwowar, A.; Barg, E. PC12 cell line: Cell types, coating

of culture vessels, differentiation and other culture conditions. Cells 2020, 9, 958.

https://doi.org/10.3390/cells9040958.

[6]. Radio, N.M.; Mundy, W.R. Developmental neurotoxicity testing in vitro: Models for

assessing chemical effects on neurite outgrowth. Neurotoxicology 2008, 29, 361–376.

https://doi.org/10.1016/j.neuro.2008.02.011.

33

[7]. Greene, L.A.; Tischler, A.S. Establishment of a noradrenergic clonal line of rat adrenal

pheochromocytoma cells which respond to nerve growth factor. Proc. Natl. Acad. Sci. USA

1976, 73, 2424–2428. https://doi.org/10.1073/pnas.73.7.2424.

[8]. Gill, J.S.; Schenone, A.E.; Podratz, J.L.; Windebank, A.J. Autocrine regulation of neurite

outgrowth from PC12 cells by nerve growth factor. Mol. Brain Res. 1998, 57, 123–131.

https://doi.org/10.1016/S0169-328X(98)00080-1.

[9]. Mielke, K.; Herdegen, T. JNK and p38 stresskinases--degenerative effectors of signal-

transduction-cascades in the nervous system. Prog. Neurobiol. 2000, 61, 45–60.

[10]. Ambrosino, C.; Mace, G.; Galban, S.; Fritsch, C.; Vintersten, K.; Black, E.; Gorospe, M.;

Nebreda, A.R. Negative feedback regulation of MKK6 mRNA stability by p38alpha

mitogen-activated protein kinase. Mol. Cell. Biol. 2003, 23, 370–81.

[11]. Ana, C.; Angel, R.N. Mechanisms and functions of p38 MAPK signalling. Biochem. J.

2010, 429, 403–417.

[12]. Raingeaud, J.; Whitmarsh, A.J.; Barrett, T.; Dérijard, B.; Davis, R.J. MKK3- and MKK6-

regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal

transduction

pathway.

Mol.

Cell.

Biol.

1996,

16,

1247–1255.

https://doi.org/10.1128/MCB.16.3.1247.

[13]. Burton, J.C.; Grimsey, N.J. Ubiquitination as a Key Regulator of Endosomal Signaling by

GPCRs. Front. Cell Dev. Biol. 2019, 7, 43. https://doi.org/10.3389/fcell.2019.00043.

34

[14]. Johnson, G.L.; Lapadat, R. Mitogen-activated protein kinase pathways mediated by ERK,

JNK,

and

p38

protein

kinases.

Science

2002,

298,

1911–1912.

https://doi.org/10.1126/science.1072682.

[15]. Cargnello, M.; Roux, P.P. Activation and function of the MAPKs and their substrates, the

MAPK-activated protein kinases. Microbiol. Mol. Biol. Rev. 2011, 75, 50–83.

https://doi.org/10.1128/mmbr.00031-10.

[16]. Vaudry, D.; Stork, P.J.S.; Lazarovici, P.; Eiden, L.E. Signaling pathways for PC12 cell

differentiation: Making the right connections. Science 2002, 296, 1648–1649.

https://doi.org/10.1126/science.1071552.

[17]. Obara, Y.; Yamauchi, A.; Takehara, S.; Nemoto, W.; Takahashi, M.; Stork, P.J.S.;

Nakahata, N. ERK5 activity is required for nerve growth factor-induced neurite outgrowth

and stabilization of tyrosine hydroxylase in PC12 cells. J. Biol. Chem. 2009, 284, 564–573.

https://doi.org/10.1074/jbc.M109.027821.

[18]. Kashino, Y.; Obara, Y.; Okamoto, Y.; Saneyoshi, T.; Hayashi, Y.; Ishii, K. ERK5

phosphorylates Kv4.2 and inhibits inactivation of the A-type current in PC12 cells. Int. J.

Mol. Sci. 2018, 19, 2008. https://doi.org/10.3390/ijms19072008.

[19]. Iwasaki, S.; Iguchi, M.; Watanabe, K.; Hoshino, R.; Tsujimoto, M.; Kohno, M. Specific

Activation of the p38 mitogen-activated protein kinase signaling pathway and induction of

neurite outgrowth in PC12 cells by bone morphogenetic protein-2. J. Biol. Chem. 1999,

35

274, 26503–26510. https://doi.org/10.1074/jbc.274.37.26503.

[20]. Liu, J.; Lin, A. Role of JNK activation in apoptosis: A double-edged sword. Cell Res. 2005,

15, 36–42. https://doi.org/10.1038/sj.cr.7290262.

[21]. Xiao, J.; Zhou, Q.; Liu, Y. Variant PC12 cell line that spontaneously differentiates and

extends

neuritic

processes.

J.

Neurosci.

Res.

2002,

69,

104–109.

https://doi.org/10.1002/jnr.10260.

[22]. Xiao, J.; Pradhan, A.; Liu, Y. Functional role of JNK in neuritogenesis of PC12-N1 cells.

Neurosci. Lett. 2006, 392, 231–234. https://doi.org/10.1016/j.neulet.2005.09.024.

[23]. Ebendal, T.; Bengtsson, H.; Söderström, S. Bone morphogenetic proteins and their

receptors: Potential functions in the brain. J. Neurosci. Res. 1998, 51, 139–146.

https://doi.org/10.1002/(SICI)1097-4547(19980115)51:2<139::AID-JNR2>3.0.CO;2-E.

[24]. Iwasaki, S.; Hattori, A.; Sato, M.; Tsujimoto, M.; Kohno, M. Characterization of the bone

morphogenetic protein-2 as a neurotrophic factor. Induction of neuronal differentiation of

PC12 cells in the absence of mitogen-activated protein kinase activation. J. Biol. Chem.

1996, 271, 17360–17365. https://doi.org/10.1074/jbc.271.29.17360.

[25]. Althini, S.; Usoskin, D.; Kylberg, A.; Kaplan, P.L.; Ebendal, T. Blocked MAP kinase

activity selectively enhances neurotrophic growth responses. Mol. Cell. Neurosci. 2004,

25, 345–354. https://doi.org/10.1016/j.mcn.2003.10.015.

[26]. Lönn, P.; Zaia, K.; Israelsson, C.; Althini, S.; Usoskin, D.; Kylberg, A.; Ebendal, T. BMP

36

enhances transcriptional responses to NGF during PC12 cell differentiation. Neurochem.

Res. 2005, 30, 753–765. https://doi.org/10.1007/s11064-005-6868-6.

[27]. Kimura, N.; Matsuo, R.; Shibuya, H.; Nakashima, K.; Taga, T. BMP2-induced apoptosis

is mediated by activation of the TAK1-p38 kinase pathway that is negatively regulated by

Smad6. J. Biol. Chem. 2000, 275, 17647–17652. https://doi.org/10.1074/jbc.M908622199.

[28]. Kudo, T.; Kanetaka, H.; Mizuno, K.; Ryu, Y.; Miyamoto, Y.; Nunome, S.; Zhang, Y.; Kano,

M.; Shimizu, Y.; Hayashi, H. Dor somorphin stimulates neurite outgrowth in PC12 cells

via activation of a protein kinase A-dependent MEK-ERK1⁄2 signaling pathway. Genes

Cells 2011, 16, 1121–1132. https://doi.org/10.1111/j.1365-2443.2011.01556.x.

[29]. Yanagisawa, M.; Nakashima, K.; Takeda, K.; Ochiai, W.; Takizawa, T.; Ueno, M.;

Takizawa, M.; Shibuya, H.; Taga, T. Inhibition of BMP2‐induced, TAK1 kinase‐mediated

neurite outgrowth by Smad6 and Smad7. Genes Cells 2001, 6, 1091–1099.

https://doi.org/10.1046/j.1365-2443.2001.00483.x.

[30]. Hirata, Y.; Takahashi, M.; Morishita, T.; Noguchi, T.; Matsuzawa, A.; Post-Translational

Modifications of the TAK1-TAB Complex. Int. J. Mol. Sci. 2017, 18, 205.

https://doi.org/10.3390/ijms18010205.

[31]. Kudo, T.; Kanetaka, H.; Watanabe, A.; Okumoto, A.; Asano, M.; Zhang, Y.; Zhao, F.;

Kano, M.; Shimizu, Y.; Tamura, S.; et al. Investigating bone morphogenetic protein (BMP)

signaling in a newly established human cell line expressing BMP receptor type II. Tohoku.

37

J. Exp. Med. 2010, 222, 121–129. https://doi.org/10.1620/tjem.222.121.

[32]. Long, Q.; Wu, B.; Yang, Y.; Wang, S.; Shen, Y.; Bao, Q.; Xu, F. Nerve guidance conduit

promoted peripheral nerve regeneration in rats. Artif. Organs 2021, 45, 616–624.

https://doi.org/10.1111/aor.13881.

[33]. Kano, Y.; Nohno, T.; Takahashi, R.; Hasegawa, T.; Hiragami, F.; Kawamura, K.; Motoda,

H.; Sugiyama, T. CAMP and calcium ionophore induce outgrowth of neuronal processes

in PC12 mutant cells in which nerve growth factor-induced outgrowth of neuronal

processes is impaired. Neurosci. Lett. 2001, 303, 21–24. https://doi.org/10.1016/S03043940(01)01676-7.

[34]. Murai, H.; Hiragami, F.; Kawamura, K.; Motoda, H.; Koike, Y.; Inoue, S.; Kumagishi, K.;

Ohtsuka, A.; Kano, Y. Differential response of heat-shock-induced p38 MAPK and JNK

activity in PC12 mutant and PC12 parental cells for differentiation and apoptosis. Acta

Med. Okayama 2010, 64, 55–62. https://doi.org/10.18926/AMO/32865.

[35]. Kudo, T.; Tominami, K.; Izumi, S.; Hayashi, Y.; Noguchi, T.; Matsuzawa, A.; Hong, G.;

Nakai, J. Characterization of PC12 cell subclones with different sensitivities to

programmed

thermal

stimulation.

Int.

J.

Mol.

Sci.

2020,

21,

8356.

https://doi.org/10.3390/ijms21218356.

[36]. Bennett, B.L.; Sasaki, D.T.; Murray, B.W.; O’Leary, E.C.; Sakata, S.T.; Xu, W.; Leisten,

J.C.; Motiwala, A.; Pierce, S.; Satoh, Y.; et al. SP600125, an anthrapyrazolone inhibitor of

38

jun N-terminal kinase. Proc. Natl. Acad. Sci. USA 2001, 98, 13681–13686.

https://doi.org/10.1073/pnas.251194298.

[37]. Vaishnav, D.; Jambal, P.; Reusch, J.E.B.; Pugazhenthi, S. SP600125, an inhibitor of c-Jun

N-terminal kinase, activates CREB by a p38 MAPK-mediated pathway. Biochem. Biophys.

Res. Commun. 2003, 307, 855–860. https://doi.org/10.1016/S0006-291X(03)01287-7.

[38]. Bonni, A.; Ginty, D.D.; Dudek, H.; Greenberg, M.E. Serine 133-phosphorylated CREB

induces transcription via a cooperative mechanism that may confer specificity to

neurotrophin

signals.

Mol.

Cell.

Neurosci.

1995,

6,

168–183.

https://doi.org/10.1006/mcne.1995.1015.

[39]. Angell, R.M.; Atkinson, F.L.; Brown, M.J.; Chuang, T.T.; Christopher, J.A.; Cichy-Knight,

M.; Dunn, A.K.; Hightower, K.E.; Malkakorpi, S.; Musgrave, J.R.; et al. N-(3-Cyano4,5,6,7-Tetrahydro-1-Benzothien-2-Yl)amides as potent, selective, inhibitors of JNK2 and

JNK3.

Bioorganic

Med.

Chem.

Lett.

2007,

17,

1296–1301.

https://doi.org/10.1016/j.bmcl.2006.12.003.

[40]. Nunome, S.; Kanetaka, H.; Kudo, T.; Endoh, K.; Hosoda, H.; Igarashi, K. In vitro

evaluation of biocompatibility of Ti-Mo-Sn-Zr superelastic alloy. J. Biomater. Appl. 2015,

30, 119–130. https://doi.org/10.1177/0885328215569892.

[41]. Hayashi, Y.; Otsuka, K.; Ebina, M.; Igarashi, K.; Takehara, A.; Matsumoto, M.; Kanai, A.;

Igarashi, K.; Soga, T.; Matsui, Y. Distinct requirements for energy metabolism in mouse

39

primordial germ cells and their reprogramming to embryonic germ cells. Proc. Natl. Acad.

Sci. USA 2017, 114, 8289–8294. https://doi.org/10.1073/pnas.1620915114.

40

Tables and Figures

Table 1

Primer sequences for quantitative real-time polymerase chain reaction (QRT-PCR).

Gene

Forward Primer (5′-3′)

Reverse Primer (5′-3′)

β3-tubulin

TCCACCTTCATCGGCAACA

CGGTGAACTCCATCTCATCCA

Smad6

CACTGCTCCGGGTGAATTCTC

AGTATGCCACGCTGCACCA

Smad7

AGCAAGAGTCAGCACTGCCAAG

TGACAACTGAAATGCTGATCCAAAG

MKK3

GTCTGGAGCCTTGGCATCAC

CCTGCTTCAGCTGCTGGAAC

p38α

ATGCAGTCCAGCTCCACGTC

TCCTAACACAGCATGGCCACA

p38β

GGCAAAGATATCCTCGGAGCA

TGGTCACTGTCTAGCACCAGCA

p38γ

TGGCTGTGAACGAGGACTGTG

GATGACCTCTGGTGCCCGATA

p38δ

GAAGGTCCAGTATTTGGTGTACCAG

CTTCATTCACGGCCAGGTTG

β-actin

GGAGATTACTGCCCTGGCTCCTA

GACTCATCGTACTCCTGCTTGCTG

41

Figure 1. Comparison of temperature-controlled repeated thermal stimulation (TRTS)-induced

neurite-bearing cells (%) among PC12 parental, PC12-P1F1, and PC12-P1D10 cell lines. (a)

We evaluated temperature changes in the culture medium during TRTS. Briefly, 24 h before

thermal evaluation, a cell-free culture medium was transferred into a 24-well culture plate. Then,

temperatures of the culture medium during TRTS (18 h/day) were recorded every 60 s for 24

h. The data represent the average temperature changes of four independent replicates. (b) Cells

were exposed to TRTS for 18 h per day for 7 days, and the percentage of neuritogenesis was

evaluated. Representative phase-contrast micrographs of cultured cells and the data of neuritebearing cells on day 7 with or without TRTS of three cell lines: PC12 parental cells (PC12-PA),

42

PC12-P1F1 cells, and PC12-P1D10 cells. Scale bars: 100 μm. The data represent the means ±

standard deviation of three replicates. * p < 0.05 vs. control; ** p < 0.01 vs. control; n.s., not

significant vs. control.

Figure 2. Effect of MAPK inhibitors on TRTS-induced differentiation in PC12-P1F1 cells.

PC12-P1F1 cells were pretreated with MAPK inhibitors before TRTS. (a–e) Phase-contrast

images of the cells on day 7 after TRTS alone (a) or pretreated with U0126 (b), BIX02189 (c),

43

SB2003580 (d), or SP600125 (e). Scale bars: 100 μm. (f) PC12-P1F1 cells were exposed to

TRTS for 18 h per day for 7 days with or without pretreatment with MAPK inhibitors, and a

control group was incubated with no inhibitor and no TRTS exposure. The percentage of

neurite-bearing cells on day 7 was determined. The data represent the means ± standard

deviation of three replicates. † p < 0.05 vs. control; †† p < 0.01 vs. control; ** p < 0.01 vs. TRTS

alone.

44

Figure 3. Time course and live imaging of SP600125-mediated enhancement of TRTS-induced

neuritogenesis in PC12-P1F1 cells. PC12-P1F1 or PC12-P1D10 cells were incubated with

BMP4 (40 ng/mL) or NGF (50 ng/mL) for 7 days. Furthermore, PC12-P1F1 or PC12-P1D10

cells were also pretreated with SP600125 (5.0 μM) or BMP4 (40 ng/mL) with TRTS 18 h/day

for 7 days. PC12-P1F1 (a,c) and PC12-P1D10 cells (b,d) were scored for neurite outgrowth

after 0–7 days of incubation with the indicated conditions. (a–d) The data represent the means

± standard deviation of four replicates. * p < 0.05; ** p < 0.01. (e–j) Representative live images

of PC12-P1F1 cells treated without stimuli (a control) (e), BMP4 alone, (f), NGF alone (g),

TRTS alone (h), TRTS plus SP600125 (i), and TRTS plus BMP4 (j). (k–p) Representative live

cell images of PC12-P1D10 cells treated without stimuli (a control) (k), BMP4 alone, (l), NGF

alone (m), TRTS alone (n), TRTS plus SP600125 (o), and TRTS plus BMP4 (p). (e–p) Scar

bars: 100 μm. (q) The averaged neurite length of neurite-bearing PC12-P1F1 cells 7 days after

the indicated stimulations. The data represent the means ± standard deviation of ten replicates.

††

p < 0.01 vs. BMP alone; ** p < 0.01 vs. TRTS alone; n.s., not significant.

Figure 4. Dose-dependent SP600125-mediated enhancement of TRTS-induced neuritogenesis

in PC12-P1F1 cells. PC12-P1F1 cells were pretreated with SP600125 (0–10 μM) with or

45

without TRTS (18 h/day for 7 days). (a–d) Representative phase-contrast images of PC12-P1F1

cells treated with the indicated concentrations of SP600125 in the absence of TRTS: 0 μM (a),

2.5 μM (b), 5 μM (c), and 10 μM (d). (e–j) Representative phase-contrast images of PC12P1F1 cells on day 7 incubated with the indicated concentrations of SP600125 in the presence

of TRTS: 0 μM (e), 0.625 μM (f), 1.25 μM (g), 2.5 μM (h), 5 μM (i), and 10 μM (j). Scale bars:

100 μm. (k,l) PC12-P1F1 cells were scored for neurite outgrowth after 7 days of incubation.

The data represent the means ± standard deviation of three replicates. * p < 0.05 vs. control; **

p < 0.01 vs. control (k), or TRTS alone (l).

Figure 5. Effects of various treatment times with 0.5 μM SP600125 on PC12-P1F1

neuritogenesis while undergoing TRTS exposure. (a) Schematic representation of the treatment

times of PC12-P1F1 cells with SP600125 in the presence of TRTS. PC12-P1F1 cells were

stimulated with SP600125 under TRTS exposure as follows: all 7 days (TRTS + SP-A7), first

3 days (TRTS + SP-F3), and last 4 days (TRTS + SP-L4). (b) Phase-contrast images of PC1246

P1F1 cells on day 7. Scale bars: 100 μm. (c) Percentage of neurite-bearing cells on day 7. Cells

that did not undergo TRTS or SP600125 treatment were defined as the negative control group.

The data represent the means ± standard deviation of three replicates.

##

p < 0.01; n.s., not

significant; †† p < 0.01 vs. control; ** p < 0.01 vs. TRTS alone.

Figure 6. Effects of SP600125 and the other JNK inhibitors (TCSJNK6o, AS601245, and

TCSJNK5a) on TRTS-mediated neuritogenesis in PC12-P1F1 cells. PC12-P1F1 cells were

pretreated with 5.0 μM SP600125, 10 μM TCSJNK6o, 2.0 μM AS601245, or 20 nM

TCSJNK5a and then exposed to TRTS for 18 h per day for 7 days. (a) Representative phase47

contrast images of PC12-P1F1 cells on day 7 in the presence of TRTS and the chemical

structures of the indicated JNK inhibitors. Scale bars: 100 μM. (b) The percentage of neuritebearing cells on day 7 was counted using microscopy. The data represent the means ± standard

deviation of three replicates.

††

p < 0.01 vs. control; ** p < 0.01 vs. TRTS alone; n.s., not

significant vs. TRTS alone.

Figure 7. Effect of SP600125 negative control (SP-NC) on TRTS-mediated neuritogenesis in

PC12-P1F1 cells. PC12-P1F1 cells were pretreated with 0.5 μM SP600125 and SP-NC,

respectively, and then exposed to TRTS for 18 h per day for 7 days. (a,b) Chemical structures

of SP600125 (a) and SP-NC (b) and representative phase-contrast images on day 7 of TRTS48

treated PC12-P1F1 cells in the presence of each compound. Scale bars: 100 μm. (c) Percentage

of neurite-bearing cells on day 7. The data represent the means ± standard deviation of three

replicates. †† p < 0.01 vs. control; ** p < 0.01 vs. TRTS alone.

Figure 8. Suppression of TRTS plus SP600125-mediated neuritogenesis by U0126 in PC12P1F1 cells. (a–d) PC12-P1F1 cells were treated with 40 ng/mL bone morphogenetic protein 4

(BMP4) as a control for 7 days in the presence or absence of U0126. Representative phasecontrast images of PC12-P1F1 cells on day 7 after treatment with (a) 0 μM, (b) 0.31 μM, (c)

0.63 μM, and (d) 1.25 μM U0126. (e–h) PC12-P1F1 cells were exposed to TRTS plus

SP600125 for 7 days in the presence or absence of U0126. Representative phase-contrast

images of PC12-P1F1 cells on day 7 after treatment with (e) 0 μM, (f) 0.31 μM, (g) 0.63 μM,

and (h) 1.25 μM U0126. Scale bars: 100 μm. (i,j) PC12-P1F1 cells were stimulated with 40

ng/mL BMP4 (i) or exposed to TRTS plus SP600125 (j) for 7 days, and the rate of neuritebearing cells was determined on day 7. The data represent the means ± standard deviation of

three replicates. †† p < 0.01 vs. control (i) or TRTS alone (j); ** p < 0.01 vs. BMP4 alone (i) or

vs. TRTS plus SP600125 only (j); n.s., not significant vs. TRTS alone (j).

49

Figure 9. Suppression of TRTS plus SP600125-mediated neuritogenesis by LDN193189 in

PC12-P1F1 cells. (a–d) PC12-P1F1 cells were treated with 40 ng/mL BMP4 as a control for 7

days in the presence or absence of LDN193189. Representative phase-contrast images of PC12P1F1 cells on day 7 after treatment with (a) 0 μM, (b) 0.03 μM, (c) 0.06 μM, and (d) 0.12 μM

LDN193189. (e–h) PC12-P1F1 cells were exposed to TRTS plus SP600125 for 7 days in the

presence or absence of LDN193189. Representative phase-contrast images of PC12-P1F1 cells

on day 7 after treatment with (e) 0 μM, (f) 0.03 μM, (g) 0.06 μM, and (h) 0.12 μM LDN193189.

Scale bars: 100 μm. (i,j) PC12-P1F1 cells were stimulated with 40 ng/mL BMP4 (i) or exposed

to TRTS plus SP600125 (j) for 7 days, and the rate of neurite-bearing cells on day 7 was

determined. The data represent the means ± standard deviation of three replicates. †† p < 0.01

vs. control (i) or TRTS alone (j); n.s., not significant vs. control (i) or TRTS alone (j); ** p <

0.01 vs. TRTS plus SP600125 only (j).

50

Figure 10. (a–h) Effects of TRTS in the presence or absence of SP600125 on gene expressions

in PC12-P1F1 cells. PC12-P1F1 cells were incubated with BMP4 (40 ng/mL) or SP600125

(10.0 μM) for 7 days. In addition, PC12-P1F1 cells were also treated with TRTS for 18 h per

day for 7 days in the presence of the indicated SP600125 concentrations. The target mRNA

expression was normalized to that of the internal control β-actin. β3-tubulin was used as a

neuronal differentiation marker of the cells. For each indicated gene, results are presented as

51

fold changes relative to day 0 of the control: β3-tubulin (a), Smad6 (b), Smad7 (c), MKK3 (d),

p38α (e), p38β (f), p38γ (g), p38δ (h). The data represent the means ± standard deviation of

three replicates. # p < 0.05; ## p < 0.01; † p < 0.05 vs. day 0 control; †† p < 0.01 vs. day 0 control;

* p < 0.05 vs. day 7 control; ** p < 0.01 vs. day 7 control; n.s., not significant.

Figure 11. Effects of TRTS in the presence or absence of AS601245/TCSJNK5a on gene

expressions in PC12-P1F1 cells. (a,b) PC12-P1F1 cells were incubated with AS601245 (2.0

μM) or TCSJNK5a (20.0 nM) for 7 days. In addition, PC12-P1F1 cells were also treated with

TRTS for 18 h per day for 7 days in the presence of AS601245 (2.0 μM) or TCSJNK5a (20.0

nM). The target mRNA expression was normalized to that of the internal control β-actin. For

each indicated gene, results are presented as fold changes relative to day 0 control: Smad6 (a),

Smad7 (b). The data represent the means ± standard deviation of three replicates. † p < 0.05

vs. day 0 control; †† p < 0.01 vs. day 0 control; n.s., not significant.

52

Acknowledgments

If anyone asked about my doctoral progress, I would say proudly that I achieved my goal of

study abroad and have spend a wonderful study life in Tohoku University as an international

student. When I first came to campus, I received a warm greeting from Prof. Keiichi Sasaki ,

who is a lovely dean and kindly made a impressive video to teach students how to walk on the

snow/ice. I also got a chance to participant the group meeting of Prof. Hiroshi Egusa’s team.

My deepest gratefulness goes formost to my supervisor Prof. Guang Hong who offered me

great research opportunities and directed the whole academic schedule. With the excellent trilingual ability, Prof. Hong support greatly of liasion between international student and school

education. Many thanks to Sun Lu sensei for warm friendship, constantly help in life and

patiently guidance in the academic work, and communicated with Prf. Hong and school

administration .

It is my great honor to participant the experiments program of cooperation between Prof.

Hong and Prof. Junichi Nakai, and have the oppoprtunity to work in Oral Physiology

Laboratory. I would sincerely thanks to Tada-aki Kudo Sensei for walking me through all the

stages of experience in the thesis experiment, discussing every study plan patiently, and

correcting errors during the progress, and thanks to Tominami sensei for providing instruction

to experiments and article. Without these guidances I could not finish the thesis experiment.

During the research, I also appretiated the kindness and help from Chiba Sensei, Ando Sensei

53

and Mr Tateyama.

I also owe my sincere gratitude to the students fellow : Zhang YD, Chen JD, Ma AB, Miao

C, Yang H, Wang RX, Yang KH, Alshafei.N, Kyaw Zaww, Wei W, Liu XC, Zeng Q, Yu XH, Li

JJ, thank you for sharing the friendship and spend a good time in campus with me.

Last, I am also thankful for the selfishless support and love from my family, parents and

grandparents, uncles and aunts, especially to my little cousin Luo Zhaoxi.

Following content is acknowledgement of the dissertaion:

Author Contributions: Conceptualization, Y.-R.L., T.-a.K., K.T., T.T. and G.H.;

methodology, T.-a.K. and Y.H.; formal analysis, Y.-R.L., T.-a.K., K.T., Y.H. and G.H.;

investigation, Y.-R.L., T.-a.K., K.T. and Y.H.; resources, T.-a.K., K.T., S.I., Y.H., T.N., J.N., G.H.

and H.W.; data curation, Y.-R.L., T.-a.K. and K.T.; writing—original draft preparation, Y.-R.L.

and T.-a.K.; writing—review and editing, Y.-R.L., T.-a.K., K.T., S.I., T.T., Y.H., T.N., A.M., J.N.,

G.H. and H.W.; supervision, A.M., J.N., G.H. and H.W.; project administration, T.-a.K.; funding

acquisition, T.-a.K., K.T., S.I., T.T., Y.H., T.N., A.M., J.N., G.H. and H.W. All authors have read

and agreed to the published version of the manuscript.

Funding: This work was partially supported by grants from the Japan Society for the

Promotion of Science (KAKENHI grant numbers 16K11643 and K21K099290) and by the

Cooperative Research Project Program of Joint Usage/Research Center at the Institute of

Development, Aging, and Cancer, Tohoku University.

54

...