Lineage tracing analysis defines erythropoietin-producing cells as a distinct subpopulation of resident fibroblasts with unique behaviors

概要

主論文
basic research

www.kidney-international.org

Lineage tracing analysis defines erythropoietinproducing cells as a distinct subpopulation see commentary on page 230
OPEN
of resident fibroblasts with unique behaviors
Keiichi Kaneko1, Yuki Sato1,2, Eiichiro Uchino1,3, Naoya Toriu1, Mayo Shigeta4, Hiroshi Kiyonari4,
Shuichiro Endo1,7, Shingo Fukuma5 and Motoko Yanagita1,6
1

Department of Nephrology, Graduate School of Medicine, Kyoto University, Kyoto, Japan; 2Medical Innovation Center, TMK Project,
Graduate School of Medicine, Kyoto University, Kyoto, Japan; 3Department of Biomedical Data Intelligence, Graduate School of Medicine,
Kyoto University, Kyoto, Japan; 4Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics
Research, Kobe, Japan; 5Human Health Sciences, Graduate School of Medicine, Kyoto University, Kyoto, Japan; and 6Institute for the
Advanced Study of Human Biology (WPI-ASHBi), Kyoto University, Kyoto, Japan

Erythropoietin (Epo) is produced by a subpopulation of
resident fibroblasts in the healthy kidney. We have
previously demonstrated that, during kidney fibrosis,
kidney fibroblasts including Epo-producing cells
transdifferentiate into myofibroblasts and lose their Epoproducing ability. However, it remains unclear whether
Epo-producing cells survive and transform into
myofibroblasts during fibrosis because previous studies did
not specifically label Epo-producing cells in
pathophysiological conditions. Here, we generated
EpoCreERT2/D mice, a novel mouse strain that enables
labeling of Epo-producing cells at desired time points and
examined the behaviors of Epo-producing cells under
pathophysiological conditions. Lineage-labeled cells that
were producing Epo when labeled were found to be a small
subpopulation of fibroblasts located in the interstitium of
the kidney, and their number increased during
phlebotomy-induced anemia. Around half of lineagelabeled cells expressed Epo mRNA, and this percentage was
maintained even 16 weeks after recombination, supporting
the idea that a distinct subpopulation of cells with Epoproducing ability makes Epo repeatedly. During fibrosis
caused by ureteral obstruction, EpoCreERT2/D-labeled cells
were found to transdifferentiate into myofibroblasts with
concomitant loss of Epo-producing ability, and their
numbers and the proportion among resident fibroblasts
increased during fibrosis, indicating their high proliferative
capacity. Finally, we confirmed that EpoCreERT2/D-labeled
cells that lost their Epo-producing ability during fibrosis
regained their ability after kidney repair due to relief of the
ureteral obstruction. Thus, our analyses have revealed
previously unappreciated characteristic behaviors of Epoproducing cells, which had not been clearly distinguished
from those of resident fibroblasts.
Correspondence: Motoko Yanagita, Department of Nephrology, Graduate
School of Medicine, Kyoto University, Shogoin-Kawahara-cho 54, Sakyo-ku,
Kyoto 606-8507, Japan. E-mail: motoy@kuhp.kyoto-u.ac.jp
7

Present address of SE is Shiga General Hospital, Shiga 524-8524, Japan.

Received 9 May 2021; revised 16 April 2022; accepted 27 April 2022;
published online 27 May 2022
280

Kidney International (2022) 102, 280–292; https://doi.org/10.1016/
j.kint.2022.04.026
KEYWORDS: erythropoietin; kidney fibrosis; renal anemia; renal Epo-producing
cells (REP cells)
Copyright ª 2022, International Society of Nephrology. Published by
Elsevier Inc. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).

Translational Statement
Although we and others showed previously that kidney
fibroblasts, including erythropoietin (Epo)-producing
cells, transdifferentiate into myofibroblasts in kidney
diseases, the behavior of Epo-producing cells remains
unclear, because previous studies do not specifically label Epo-producing cells. Here, we generated EpoCreERT2/þ
mice to label Epo-producing cells at desired time points
and thereby revealed the unique behaviors of Epoproducing cells, such as their sustained Epo-producing
ability in healthy kidneys, their loss of Epo-producing
ability and rapid proliferation during fibrosis, and their
reacquisition of Epo-producing ability after kidney repair.
Further analysis of this subpopulation will provide insights that may yield new therapeutic approaches to
renal anemia.

T

he hormone erythropoietin (Epo) is essential for erythropoiesis.1 In adults, Epo is produced mainly by resident
fibroblasts in the kidney and is regulated at transcriptional
levels through a hypoxia-inducible factor–dependent mechanism under physiological conditions.2–5 Epo-producing cells are
distributed mainly in the deep cortex and outer medulla,4,6 the
regions that are physiologically hypoxic and sensitive to subtle
changes in oxygen delivery.7 Under physiological conditions,
Epo-producing cells are a small subpopulation of resident fibroblasts detectable around the corticomedullary junctions,
whereas under hypoxic conditions, they become detectable in a
broader area of the cortex.8,9
Although the transcriptional regulation of Epo has been
analyzed intensively, a remaining unanswered question is
Kidney International (2022) 102, 280–292

K Kaneko et al.: Behavior of Epo-producing cells

whether Epo-producing cells constitute a distinct and specialized subpopulation of resident fibroblasts, or in contrast, all
resident fibroblasts possess the capacity to produce Epo.
Yamazaki et al. have demonstrated that most resident fibroblasts in the kidneys of inherited super anemic mice
(ISAM), which lack Epo-producing ability in the kidneys and
are severely anemic, are lineage-labeled with Epo-Cre.10
Although this finding suggests that all kidney fibroblasts
have the potential to produce Epo, the lineage-labeled cells in
the study are the cells with a history of Epo expression from
the developmental period.
Indeed, lineage-tracing studies analyzing the cells currently
producing Epo in the adult kidneys are lacking, and the behaviors of Epo-producing cells under pathologic conditions
also remain unknown. In our previous study, we demonstrated that resident fibroblasts including Epo-producing cells
are lineage-labeled with myelin protein zero Cre (P0-Cre), and
that, during kidney injury, they transdifferentiate into myofibroblasts and lose their potential to produce Epo, resulting
in kidney fibrosis and renal anemia.11,12 We also confirmed
that Epo-producing ability can be regained in myofibroblasts
by the induction of severe anemia. However, what is not fully
clear from our previous study is whether the cells that had
been capable of producing Epo in the healthy kidney die, or
rather, survive and transdifferentiate into myofibroblasts
during kidney fibrosis. This lack of clarity is due to the fact
that all kidney fibroblasts, including Epo-producing cells, are
labeled in P0-Cre mice in the same way, so we could not trace
Epo-producing cells specifically.
Previous studies have identified Epo-producing cells by
means of in situ hybridization or by using transgenic mice in
which green fluorescent protein is knocked-in at the Epo
locus.4,13,14 Therefore, Epo-producing cells could not be
observed in the kidneys with impaired Epo-producing ability,
and the behavior of Epo-producing cells could not be
monitored while Epo production was paused.
In the present study, to address these problems, we established EpoCreERT2/þ mice, a novel mouse line that allows us to
label Epo-producing cells at desired time points and to trace
Epo-producing cells even while Epo production is paused.
Utilizing this novel mouse line, we traced the fate of Epoproducing cells under physiological and pathologic conditions and identified Epo-producing cells as being a distinct
subpopulation of resident fibroblasts with unique phenotypes.
METHODS
Study approval
All animal studies were approved by the Animal Research Committee, Kyoto University Graduate School of Medicine, and the
Institutional Animal Care and Use Committee of the RIKEN Center
for Biosystems Dynamic Research, Kobe branch, and performed in
accordance with the guidelines of Kyoto University and the RIKEN
Kobe branch, as well as US National Institutes of Health guidelines.
Generation of EpoCreERT2/þ mice
To construct a targeting vector, genomic fragments containing the
mouse Epo gene were isolated from a bacterial artificial chromosome
Kidney International (2022) 102, 280–292

basic research

(BAC) clone (RP23-129L22, BACPAC Resources). We inserted a
CreERT2 cassette (Artemis Pharmaceuticals), polyA tail, and a FRTflanked PGK-Neo cassette into the Epo ATG start site of exon 1
(Figure 1a). TT2 embryonic stem (ES) cells were electroporated with
targeting vector.15 G418-resistant ES colonies were selected, and
correctly targeted clones were identified by Southern blotting
(Figure 1b). Two clones of ES cells (#21 and #55) were injected into
8-cell stage embryos to obtain mouse chimeras, which were crossed
with wild-type C57BL/6J mice for germline transmission. Correct
targeting was also confirmed by genomic polymerase chain reaction
(PCR) of the tail genome (Figure 1c). Primers utilized were as follows: primer A: CTACAGAACTTCCAAGGATG; primer B:
ACTTCTCGGCCAAACTTCAC; primer C: CTCGACCAGTTTAGTTACCC. EpoCreERT2/þ mice (Accession No. CDB1003K: http://
www2.clst.riken.jp/arg/mutant%20mice%20list.html) were backcrossed to C57BL/6J mice at least 7 times. The EpoCreERT2/þ mouse
strain can be used by other researchers, subject to agreement with
the corresponding author on terms and conditions of use.
A detailed description is provided in the Supplementary Full
Methods of protocols used for the following: (i) animals; (ii) anemia
induction and the administration of tamoxifen; (iii) kidney injury
models; (iv) immunostaining; (v) in situ hybridization; (vi) quantitative assessment; (vii) real-time reverse transcription quantitative
(RT-q) PCR analysis; (viii) enzyme-linked immunosorbent assay
(ELISA); and (ix) statistical analysis. ...

この論文で使われている画像