NAIL: An evolutionarily conserved lncRNA essential for licensing coordinated activation of p38 and NFκB in colitis

1 Neurath MF. Cytokines in inflammatory bowel disease. Nat Rev Immunol

2014;14:329–42.

2 Shen Z-­H, Zhu C-­X, Quan Y-­S, et al. Relationship between intestinal microbiota

and ulcerative colitis: mechanisms and clinical application of probiotics and fecal

microbiota transplantation. World J Gastroenterol 2018;24:5–14.

3 Atreya I, Atreya R, Neurath MF. NF-­kappaB in inflammatory bowel disease. J Intern

Med 2008;263:591–6.

4 Cohn HM, Dave M, Loftus EV. Understanding the cautions and contraindications of

immunomodulator and biologic therapies for use in inflammatory bowel disease.

Inflamm Bowel Dis 2017;23:1301–15.

5 Karin M, Greten FR. NF-­kappaB: linking inflammation and immunity to cancer

development and progression. Nat Rev Immunol 2005;5:749–59.

6 O’Connor PM, Lapointe TK, Beck PL, et al. Mechanisms by which inflammation may

increase intestinal cancer risk in inflammatory bowel disease. Inflamm Bowel Dis

2010;16:1411–20.

7 Ruland J. Return to homeostasis: downregulation of NF-κB responses. Nat Immunol

2011;12:709–14.

8 Derrien T, Johnson R, Bussotti G, et al. The GENCODE v7 catalog of human long

noncoding RNAs: analysis of their gene structure, evolution, and expression. Genome

Res 2012;22:1775–89.

9 Harrow J, Frankish A, Gonzalez JM, et al. GENCODE: the reference human genome

annotation for the encode project. Genome Res 2012;22:1760–74.

10 Diederichs S. The four dimensions of noncoding RNA conservation. Trends Genet

2014;30:121–3.

11 Chen J, Shishkin AA, Zhu X, et al. Evolutionary analysis across mammals reveals

distinct classes of long non-­coding RNAs. Genome Biol 2016;17:19.

12 Garber M, Yosef N, Goren A, et al. A high-­throughput chromatin immunoprecipitation

approach reveals principles of dynamic gene regulation in mammals. Mol Cell

2012;47:810–22.

13 Barish GD, Yu RT, Karunasiri M, et al. Bcl-6 and NF-­kappaB cistromes mediate

opposing regulation of the innate immune response. Genes Dev 2010;24:2760–5.

14 Schmidt SF, Larsen BD, Loft A, et al. Acute TNF-­induced repression of cell identity

genes is mediated by NFκB-­directed redistribution of cofactors from super-­enhancers.

Genome Res 2015;25:1281–94.

15 Jin F, Li Y, Dixon JR, et al. A high-­resolution map of the three-­dimensional chromatin

interactome in human cells. Nature 2013;503:290–4.

16 Rogler G, Brand K, Vogl D, et al. Nuclear factor kappaB is activated in

macrophages and epithelial cells of inflamed intestinal mucosa. Gastroenterology

1998;115:357–69.

17 Schreiber S, Nikolaus S, Hampe J. Activation of nuclear factor kappa B inflammatory

bowel disease. Gut 1998;42:477–84.

18 Zhang R, Ito S, Nishio N, et al. Dextran sulphate sodium increases splenic Gr1(+)

CD11b(+) cells which accelerate recovery from colitis following intravenous

transplantation. Clin Exp Immunol 2011;164:417–27.

Akıncılar SC, et al. Gut 2020;0:1–15. doi:10.1136/gutjnl-2020-322980

19 Trottier MD, Irwin R, Li Y, et al. Enhanced production of early lineages of

monocytic and granulocytic cells in mice with colitis. Proc Natl Acad Sci U S A

2012;109:16594–9.

20 Geissmann F, Jung S, Littman DR. Blood monocytes consist of two principal subsets

with distinct migratory properties. Immunity 2003;19:71–82.

21 Bain CC, Scott CL, Uronen-­Hansson H, et al. Resident and pro-­inflammatory

macrophages in the colon represent alternative context-­dependent fates of the same

Ly6Chi monocyte precursors. Mucosal Immunol 2013;6:498–510.

22 Zigmond E, Varol C, Farache J, et al. Ly6C hi monocytes in the inflamed colon give rise

to proinflammatory effector cells and migratory antigen-­presenting cells. Immunity

2012;37:1076–90.

23 Youssif C, Cubillos-­Rojas M, Comalada M, et al. Myeloid p38α signaling promotes

intestinal IGF-1 production and inflammation-­associated tumorigenesis. EMBO Mol

Med 2018;10.

24 Mayle A, Luo M, Jeong M, et al. Flow cytometry analysis of murine hematopoietic

stem cells. Cytometry A 2013;83:27–37.

25 Waddell A, Ahrens R, Tsai Y-­T, et al. Intestinal CCL11 and eosinophilic inflammation is

regulated by myeloid cell-­specific RelA/p65 in mice. J Immunol 2013;190:4773–85.

26 Otsuka M, Kang YJ, Ren J, et al. Distinct effects of p38alpha deletion in myeloid

lineage and gut epithelia in mouse models of inflammatory bowel disease.

Gastroenterology 2010;138:1255–65. 65 e1-9.

27 Bain CC, Mowat AM. Macrophages in intestinal homeostasis and inflammation.

Immunol Rev 2014;260:102–17.

28 Gschwandtner M, Derler R, Midwood KS. More than just attractive: how CCL2

influences myeloid cell behavior beyond chemotaxis. Front Immunol 2019;10:2759.

29 Chew J, Biswas S, Shreeram S, et al. WIP1 phosphatase is a negative regulator of NF-­

kappaB signalling. Nat Cell Biol 2009;11:659–66.

30 Kim C, Sano Y, Todorova K, et al. The kinase p38 alpha serves cell type-­specific

inflammatory functions in skin injury and coordinates pro- and anti-­inflammatory

gene expression. Nat Immunol 2008;9:1019–27.

31 Donehower LA. Phosphatases reverse p53-­mediated cell cycle checkpoints. Proc Natl

Acad Sci U S A 2014;111:7172–3.

32 Feng S, Ollivier JF, Soyer OS. Enzyme sequestration as a tuning point in controlling

response dynamics of signalling networks. PLoS Comput Biol 2016;12:e1004918.

33 Taniguchi CM, Emanuelli B, Kahn CR. Critical nodes in signalling pathways: insights

into insulin action. Nat Rev Mol Cell Biol 2006;7:85–96.

34 Blüthgen N, Bruggeman FJ, Legewie S, et al. Effects of sequestration on signal

transduction cascades. Febs J 2006;273:895–906.

35 Schonthaler HB, Guinea-­Viniegra J, Wagner EF. Targeting inflammation by modulating

the Jun/AP-1 pathway. Ann Rheum Dis 2011;70(Suppl 1):i109–12.

36 Oeckinghaus A, Hayden MS, Ghosh S. Crosstalk in NF-κB signaling pathways. Nat

Immunol 2011;12:695–708.

37 Zhang Q, Zhang C, Chang F, et al. Wip 1 inhibits intestinal inflammation in

inflammatory bowel disease. Cell Immunol 2016;310:63–70.

38 Gorjifard S, Goldszmid RS. Microbiota-­myeloid cell crosstalk beyond the gut. J Leukoc

Biol 2016;100:865–79.

39 Sartor RB. Mechanisms of disease: pathogenesis of Crohn’s disease and ulcerative

colitis. Nat Clin Pract Gastroenterol Hepatol 2006;3:390–407.

40 Verma A, Deb DK, Sassano A, et al. Activation of the p38 mitogen-­activated protein

kinase mediates the suppressive effects of type I interferons and transforming growth

factor-­beta on normal hematopoiesis. J Biol Chem 2002;277:7726–35.

41 Geest CR, Buitenhuis M, Laarhoven AG, et al. p38 MAP kinase inhibits neutrophil

development through phosphorylation of C/EBPalpha on serine 21. Stem Cells

2009;27:2271–82.

42 Medzhitov R, Horng T. Transcriptional control of the inflammatory response. Nat Rev

Immunol 2009;9:692–703.

43 Bradbury CM, Markovina S, Wei SJ, et al. Indomethacin-­induced radiosensitization and

inhibition of ionizing radiation-­induced NF-­kappaB activation in HeLa cells occur via a

mechanism involving p38 MAP kinase. Cancer Res 2001;61:7689–96.

44 Tergaonkar V, Bottero V, Ikawa M, et al. Ikappab kinase-­independent IkappaBalpha

degradation pathway: functional NF-­kappaB activity and implications for cancer

therapy. Mol Cell Biol 2003;23:8070–83.

45 Shin EM, Hay HS, Lee MH, et al. Dead-­Box helicase DP103 defines metastatic

potential of human breast cancers. J Clin Invest 2014;124:3807–24.

46 Noda T, Sakurai N, Nozawa K, et al. Nine genes abundantly expressed in the

epididymis are not essential for male fecundity in mice. Andrology 2019;7:644–53.

47 Tokuhiro K, Ikawa M, Benham AM, et al. Protein disulfide isomerase homolog PDILT

is required for quality control of sperm membrane protein ADAM3 and male fertility

[corrected]. Proc Natl Acad Sci U S A 2012;109:3850–5.

48 Helke K, Angel P, Lu P, et al. Ceramide synthase 6 deficiency enhances inflammation in

the DSS model of colitis. Sci Rep 2018;8:1627.

49 Macartney KK, Baumgart DC, Carding SR, et al. Primary murine small intestinal

epithelial cells, maintained in long-­term culture, are susceptible to rotavirus infection.

J Virol 2000;74:5597–603.

50 Ishii KJ, Koyama S, Nakagawa A, et al. Host innate immune receptors and beyond:

making sense of microbial infections. Cell Host Microbe 2008;3:352–63.

15

Gut: first published as 10.1136/gutjnl-2020-322980 on 25 November 2020. Downloaded from http://gut.bmj.com/ on February 2, 2021 at Osaka U Seimeikagaku c/o KWE/ACCESS. Protected

by copyright.

Gut immunity

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Supplemental material

Gut

SUPPLEMENTARY FIGURE LEGENDS -/-

-/-

Sup. Figure 1: Validation of NFκB KO MEF cells. A) Western blot analysis of p65 , Ikkβ

-/-

and Ikkγ immortalized MEFs with indicated antibodies. B) EMSA was performed using either

NFκB or AP1 consensus sequence radiolabelled probes as indicated using protein extracts from

-/-

-/-

WT, p65 , Ikkβ

-/-

and Ikkγ immortalized MEFs treated with TNFα for the indicated time

-/-

-/-

points. C) RNA-seq analysis of Gm16685 expression in WT, p65 and Ikkβ immortalized

MEFs exposed to TNFα for indicated duration. D) RT-qPCR analysis of Gm16685 expression

-/-

-/-

-/-

in WT, p65 , Ikkβ and Ikkγ immortalized MEFs exposed to TNFα for indicated duration. E)

RT-qPCR analysis of Gm16685 expression in immortalized WT MEFs exposed to LPS

-/-

(100ng/ml) for indicated time points. F) RT-qPCR analysis of IL7 expression in WT, p65 ,

-/-

-/-

IKKβ and IKKγ immortalized MEFs exposed to TNFα for indicated time points. Error bars

indicate mean ± SD of three independent experiments. P values were calculated using Student's

t-test method (**, p<0.01; ***, p<0.001).

Sup. Figure 2: Conservation and analysis of Gm16685 lncRNA. A) Multiple sequence

alignment using promoter sequence of the mouse Gm16685 and sequence of 31 other species

at the same region with reference to UCSC comparative genomic track. Clustal Omega was

used for the alignment. B) Promoter motifs enrichment analysis by using Homer-v4.1.0

package. Top 10 most enriched motifs are shown. C) Prediction of different RBPs that can bind

to

Gm16685

or

loc105375914

was

performed

using

RBPmap

server

(http://rbpmap.technion.ac.il/). Venn diagram representing numbers of overlapping predicted

RBPs that can bind both Gm16685 and loc105375914 is shown. D) ChIP-seq analysis of p65

(RelA) binding in mouse dendritic and macrophage cells exposed to LPS for 2 hours based on

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Gut

published data (GSE36099 and GSE93736 or GSE93602). E) ChIP-seq analysis of RelA and

Pol2 signal in human adipocyte and IMR90 fibroblasts exposed to TNFα for 1hour based on

published data (GSE60462 and GSE43070). F) Bar plot shows the coding probability of seven

NAIL (Loc105375914 for human and Gm16685 for mouse) transcript sequences (six hNAIL

isoforms and one mNAIL) together with a known lncRNA sequence, TERC and actin gamma

1 (ACTG1) mRNA sequence as positive and negative control. Coding probability was

calculated with CPC2 tools which indicate the closeness to the coding classification hyperplane in the trained support vector machine (SVM) model. G) 293T cells were transfected with

Flag, NAIL-Flag and PKR-Flag (Protein kinase R) vectors. Total cell lysates were resolved in

SDS-PAGE gel and immunoblotted for Flag and Hsp90 proteins.

Sup. Figure 3: No difference in IL-7 expression and induction in mNAILΔNFκB mice. A)

Gene expression profiles of mouse IL7 across different mouse tissues. All the raw FPKM

values were obtained from Mouse ENCODE transcriptome data in NCBI (BioProject:

PRJNA66167, Publication: PMID 25409824). B) Gene expression analysis was performed by

RT-qPCR for mouse IL7 in the thymus tissues of mNAILWT and mNAILΔNFκB mice (n=3). C)

Total protein lysates isolated from the thymus tissues of mNAILWT and mNAILΔNFκB mice were

analysed for mouse IL7 by western blot. Actin was used for normalization. Graph shows the

quantification of IL7 western blot band intensity. D-F) Wild-type MEFs were transfected with

si-Control, mouse IL7 siRNA#1 or mouse IL7 siRNA#2. After 48h post-transfection, cells

were treated with or without TNFα and harvested for gene expression analysis or western blot.

Graphs show the gene expression analysis of D) IL7 and E) TNFα by RT-qPCR. Actin was

used as a control. Error bars indicate mean ± SD of three independent experiments. P values

were calculated using Student's t-test method (*, p<0.05; **, p<0.01; ***, p<0.001; ****,

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Supplemental material

Gut

p<0.0001; n.s., not significant). F) Cells lysate were analysed via western blot for the indicated

proteins.

Sup. Figure 4: No difference in stem cells and precursor cells between mNAILWT and

mNAILΔNFκB mice. A-E) Bone marrow cells were isolated from mNAILWT and mNAILΔNFκB

mice (n=7) and treated with or without DSS at day 8. Cells were stained for Lineage marker

cocktail, CD34, IL7ra, c-KIT, Sca-1 and CD16/32 cell surface markers. A) Cells were analysed

by FACS and firstly gated as LIN- cells. LIN- cells were further gated as KL, KSL and K-low

S-low cells based on the c-KIT and Sca-1 expression. KL cells were further gated into MEP,

CMP and GMP according to CD16/32 and CD34 expression. K-low and S-low cells were gated

for CLP population based on the IL7ra expression. Representative FACS data was shown for

mNAILWT and mNAILΔNFκB mice treated with or without DSS. Quantification of B) GMP, C)

CMP, D) MEP and E) CLP cells. Error bars indicate mean ± SD of 3 UT and 7 DSS treated

samples. P values were calculated using Student's t-test method (n.s., not significant).

Sup. Figure 5: Genome editing process did not cause non-specific global transcriptome

changes. A) RNA-seq was performed with colon tissues obtained at Day 8 from mNAILWT and

mNAILΔNFκB mice treated with or without DSS. Venn diagram representing numbers of

overlapping differentially expressed genes between different experimental groups is shown. B)

GO analysis was performed from the genes that are differentially expressed between mNAILWT

and mNAILΔNFκB mice treated with DSS.

Sup. Figure 6: mNAILΔNFκB mice are protected from DSS induced colitis. A, B) Colon

sections of the DSS treated mNAILWT and mNAILΔNFκB mice (n=3) at day 8 were stained with

mNAIL specific FISH probe (Quasar570), F4/80 (AF647) and p-p38 (AF488) antibodies.

Tissue slides were analysed for the indicated molecules by LSM800 confocal microscopy.

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Gut

Nuclei were counterstained with DAPI. Representative images for co-staining of A) mNAIL,

F4/80 and p-p38 is shown. Quantification of B) F4/80, mNAIL and p-p38 positive cells is shown

as bar graphs. Error bars indicate mean ± SD of three independent fields examined per mouse

(n=3 per group). *, p < 0.05; ****, p < 0.0001. p-values were calculated by two-tailed student’s

t-test method based on three independent experiments. C) Representative H & E staining and

D) quantification of histology scores of colon sections from DSS treated mNAILWT and

mNAILΔNFκB mice at day 8. Error bars indicate mean ± SD of three independent experiments

(n=9 for UT, n=15 for DSS treated samples)

Sup. Figure 7: NAIL alters phosphorylation of p65 and p38 but not upstream molecules.

A-B) Graphs show the gene expression analysis of A) mNAIL and B) TNFα by RT-qPCR in

intestinal epithelial cells isolated from colon tissues of mNAILWT and mNAILΔNFκB mice treated

with and without DSS for 8 days. Actin was used as a control. Error bars indicate mean ± SD

of 6 mice. P values were calculated using Student's t-test method (**, p<0.01; ***, p<0.001).

n.s., not significant. C) mNAILWT MEFs were transfected with si-Control or si-NAIL and after

48h post-transfection, cells were stimulated with TNFα for indicated time points. Cell lysates

were analyzed by western blot for the indicated proteins. D-E) Bone marrow cells isolated from

mNAILWT and mNAILΔNFκB mice (n=4) were differentiated into bone marrow derived

macrophages (BMDM) for 7 days. BMDM cells were treated with or without LPS (200ng/ml)

for 4 hours. p65 immunoprecipitation was performed. Total and co-immunoprecipitated

proteins were resolved on SDS-PAGE and immunoblotted for indicated proteins. F) Graph

shows quantification of co-precipitated Wip1 from D-E. Error bars indicate mean ± SD of four

replicates. P values were calculated using Student's t-test method (**, p<0.01).

Sup. Figure 8: Wip1 is a key determinant of NAIL action. A-C) mNAILWT and mNAILΔNFκB

MEFs were transfected with control siRNA or Wip1 siRNA. After 48h post-transfection, cells

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Supplemental material

Gut

were treated with or without TNFα and harvested for gene expression analysis or western blot.

Graphs show the gene expression analysis of A) IL1β and B) TNFα by RT-qPCR. Actin was

used as a control. C) siRNA transfected and TNFα stimulated MEFs cell lysates were analysed

via western blot for the indicated proteins. D-F) mNAILWT and mNAILΔNFκB BMDMs were

transfected with control siRNA or Wip1 siRNA. After 48h post-transfection, cells were treated

with or without LPS and harvested for gene expression analysis or western blot. Graphs show

the gene expression analysis of D) IL1β and E) TNFα by RT-qPCR. Actin was used as a control.

Error bars indicate mean ± SD of three independent experiments. P values were calculated

using Student's t-test method (***, p<0.001). F) siRNA transfected and LPS stimulated

BMDM cell lysates were analysed via western blot for the indicated proteins.

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Gut

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Gut

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Gut

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Gut

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Gut

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Gut

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Gut

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Gut

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Supplemental material

Gut

Sup-Table 1

REAGENT or RESOURCE

SOURCE

IDENTIFIER

anti-p-p38 (Thr180/Tyr182) 3D7

Cell signalling

Cat #9215S

anti-p38

Cell signalling

Cat #9212

anti-p-p65 (Ser536)

Cell signalling

Cat #3031L

anti-p65

Santa Cruz

Cat #sc-8008

anti-Actin

Sigma

Cat #A2066

GAPDH (6C5)

Santa Cruz

Cat #sc-32233

p-IKKα/β (Ser176/180)

Cell signalling

Cat #2697S

IKKα/β (H-470)

Santa Cruz

Cat #sc-7607

IKKγ (FL-419)

Santa Cruz

Cat #sc-8330

anti-p65 (ChIP, IP)

Santa Cruz

Cat #sc-372

anti-Wip1 (RIP)

Cell signalling

Cat #11901

anti-Wip1(WB)

Santa Cruz

Cat # sc-376257

Dyskerin (H-300)

Santa Cruz

Cat #sc-48794

anti-IL7

R&Dsystems

Cat # AF407

P-SEK1/MKK4(T261)

Cell signalling

Cat # 9151S

anti-SEK1/MKK4

Cell signalling

Cat # 9152S

p-TAK1 (T187)

Cell signalling

Cat # 4536S

p-IkBα (S32)

Cell signalling

Cat # 2859L

p-SAPK/JNK (Thr183/Tyr185)

Cell signalling

Cat # 9251

anti-P-MKK3/MKK6 (Ser189/207)

Cell signalling

Cat # 9231

anti-Cleaved Caspase-3 (Asp175)

Cell signalling

Cat #9664L

PE-CD11b

BD

Cat #553311

FITC-Ly6G

Biolegend

Cat #127606

BV711-Ly6C

Biolegend

Cat #128037

PE-CD34

BD

Cat #551387

PeCy7-IL7RA

BD

Cat #560733

PercpCy5.5-c-kit

BD

Cat #560557

FITC-Sca1/Anti-Ly-6A/E

BD

Cat #553335

APCcy7-CD16/32

BD

Cat #560541

APC Mouse Lineage Antibody Cocktail

BD

Cat #558074

Antibodies

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Supplemental material

AF488-p-NF-κB p65 (Ser536) (93H1)

CST

Cat #4886

AF488-p -p38 MAPK (Thr180/Tyr182) (3D7)

CST

Cat #41768

Recombinant Human TNF-alpha Protein 210

R&Dsystems

Cat #210-TA

Terminal deoxynucleotidyltransferase

Promega

Cat #M1871

RQ1 RNase-Free DNase

Promega

Cat #M6101

Recombinant RNasin ribonuclease inhibitor

Promega

Cat #N2111

T7 RNA polymerase

Promega

Cat #P2075

10X Biotin RNA labelling mix

Roche

Cat #11685597910

Tak1 inhibitor 5Z-7-Oxozeaenol

Sigma

Cat #O9890-1MG

E. coli LPS

Sigma

Cat #L2654 and #L2630

Dextran sulfate sodium salt, colitis grade

MP Biomedicals

Cat # 9011-18-1

Disuccinimidyl glutarate (DSG)

Thermoe Fisher

Cat #20593

X-tremeGENE 9 DNA transfection reagent

Roche

Cat #6365779001

X-tremeGENE siRNA transfection reagent

Roche

Cat #4476093001

Mouse: wild-type: C57BL/6

Invivos

N/A

Mouse: wild type Balb/c

Invivos

N/A

Mouse: mNAIL∆NFκB

Masa’s group

This study

MEFs: WT, p65-/-, Ikkβ-/- and Ikkγ-/-

Tergaonkar et al., 2003

N/A

RT‐qPCR_Gm16685 Fw (CCCTACAGGAAGACCAACCA)

IDT

N/A

RT‐qPCR_Gm16685 Rv (CTAGGCCATCCTCTGCTACG)

IDT

N/A

RT‐qPCR_mTNFa Fw (ACAGAAAGCATGATCCGCGAC)

IDT

N/A

RT‐qPCR_mTNFa Rv (GAAGCCCCCCATCTTTTGG) IDT

N/A

RT‐qPCR_mIL7 Fw (TGGAATTCCTCCACTGATCC) IDT

N/A

RT‐qPCR_mIL7 Rv (TGGTTCATTATTCGGGCAAT) IDT

N/A

RT‐qPCR_mActin Fw (CTGTATTCCCCTCCATCGTG) IDT

N/A

RT‐qPCR_mActin Rv (CCTCGTCACCCACATAGGAG) IDT

N/A

Gut

Chemicals, recombinants proteins,

commercial kits

Experimental Models: Organisms/Strains

Oligonucleotides

Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

placed on this supplemental material which has been supplied by the author(s)

Supplemental material

RTqPCR_mCCL2 Fw (GCCCCTCCATGTATACCAGACT) IDT

N/A

RTqPCR_mCCL2 Rv (AGACCTCTCTCTTGAGCTTGGT ) IDT

N/A

RT‐qPCR_mIL1β Fw (AAAGCTCTCCACCTCAATGG) IDT

N/A

RT‐qPCR_mIL1β Rv2 (TCTTCTTTGGGTATTGCTTGG) IDT

N/A

CRISPR Genotyping_Gm16685 Fw (GCATTCCCTTAGGTAGACCTCC) IDT

N/A

CRISPR Genotyping_Gm16685 Rv (GGGAGTGATTATGGGTGGTGAG) IDT

N/A

Gm16685 gRNA #1

(CACCTAGGGTTTAAAAGCGCATCC) IDT

N/A

Gm16685 gRNA #2

(CACCAGTCTGGGAGTTTCCGATCC) IDT

N/A

Gm16685 siRNA

(GGAATAATGATAGCAACTACT) IDT

N/A

Gm16685 siRNA

(CAACCTCTCTAATCAGTCTCTTTCT) IDT

N/A

Wip1 siRNA

(CTTGTGGGGTTTCATCAAGAAGCAG)

IDT

N/A

Mouse IL7 transcript variant 4 siRNA#1

(AGCTCAGAACTTCATGGAGAATGAA)

IDT

N/A

Mouse IL7 transcript variant 4 siRNA#1

(AAAGGACAGAUCAUUGGAAAACCCC)

IDT

N/A

Mouse IL7 siRNA#1

(GACAGGAACTGATAGTAAT)

IDT

N/A

Mouse IL7 siRNA#2

(GCATATGAGAGTGTACTGA)

IDT

N/A

pX458 –GFP Addgene

Cat #48138

pX458-DsRed Akincilar et al., 2016

N/A

Gut

Plasmids Akæ11lar SC

, et al. Gut 2020;0:1–15. doi: 10.1136/gutjnl-2020-322980

...