Screening of fatty alcohol dehydrogenase and its application on alkane production

1. Y. H. Yoo, I. J. Park, J. G. Kim, D. H. Kwak, W. S. Ji. Corrosion characteristics of aluminum alloy

in bio-ethanol blended gasoline fuel: Part 1. The corrosion properties of aluminum alloy in high

temperature fuels. Fuel 90:1208–1214 (2011).

2. R. M. Lennen, D. J. Braden, R. M. West, J. A. Dumesic, B. F. Pfleger. A process for microbial

hydrocarbon synthesis: overproduction of fatty acids in Escherichia coli and catalytic conversion

to alkanes. Biotechnol. Bioeng. 106:193–202 (2010).

3. A. Schirmer, M. A. Rude, X. Li, E. Popova, S. B. del Cardayre. Microbial biosynthesis of alkanes.

Science 329:559–562 (2010).

4. N. A. Buijs, Y. J. Zhou, V. Siewers, J. Nielsen. Long-chain alkane production by the yeast

Saccharomyces cerevisiae. Biotechnol. Bioeng. 112:1275–1279 (2015).

5. Y. J. Zhou, N. A. Buijs, Z. Zhu, J. Qin, V. Siewers, J. Nielsen. Production of fatty acid-derived

oleochemicals and biofuels by synthetic yeast cell factories. Nat. Commun. 7:11709 (2016).

6. Y. J. Choi, S. Y. Lee. Microbial production of short-chain alkanes. Nature 502:571–574 (2013).

7. Y. X. Cao, W. H. Xiao, J. L. Zhang, Z. X. Xie, M. Z. Ding, Y. J. Yuan. Heterologous biosynthesis

and manipulation of alkanes in Escherichia coli. Metab. Eng. 38:19–28 (2016).

8. Y. Xu, J. Li, M. Zhang, D. Wang. Modified simultaneous saccharification and fermentation to

enhance bioethanol titers and yields. Fuel 215:647–654 (2018).

9. J. M. Perez, F. A. Arenas, G. A. Pradenas, J. M. Sandoval, C. C. Vasquez. Escherichia coli YqhD

exhibits aldehyde reductase activity and protects from the harmful effect of lipid peroxidationderived aldehydes. J. Biol. Chem. 283:7346–7353 (2008).

10. Z. Fatma, K. Jawed, A. J. Mattam, S. S. Yazdani. Identification of long chain specific aldehyde

reductase and its use in enhanced fatty alcohol production in E. coli. Metab. Eng. 37:35–45 (2016).

11. X. Song, H. Yu, K. Zhu. Improving alkane synthesis in Escherichia coli via metabolic engineering.

Appl. Microbiol. Biotechnol. 100:757–767 (2016).

12. G. M. Rodriguez, S. Atsumi. Toward aldehyde and alkane production by removing aldehyde

reductase activity in Escherichia coli. Metab. Eng. 25:227–237 (2014).

13. K. Motohashi. A simple and efficient seamless DNA cloning method using SLiCE from Escherichia

coli laboratory strains and its application to SLiP site-directed mutagenesis. BMC Biotechnol. 15:47

(2015).

14. L. J. Rajakovich, H. Nørgaard, D. M. Warui, W. C. Chang, N. Li, S. J. Booker, C. Krebs, J. M. J.

Bollinger, M. E. Pandelia. Rapid reduction of the diferric-peroxyhemiacetal intermediate in

73

CHAPTER 3

aldehyde-deformylating oxygenase by a cyanobacterial ferredoxin: evidence for a free-radical

mechanism. J. Am. Chem. Soc. 137:11695–11709 (2015).

15. D. M. Warui, N. Li, H. Nogaard, C. Krebs, J. M. J. Bollinger, S. J. Booker. Detection of formate,

rather than carbon monoxide, as the stoichiometric coproduct in conversion of fatty aldehydes to

alkanes by a cyanobacterial aldehyde decarbonylase. J. Am. Chem. Soc. 133:3316–3319 (2011).

16. J. Jaroensuk, P. Intasian, C. Kiattisewee, P. Munkajohnpon, P. Chunthaboon, S. Buttranon, D.

Trisrivirat, T. Wongnate, S. Maenpuen, R. Tinikul, P. Chaiyen. Addition of formate dehydrogenase

increases the production of renewable alkane from an engineered metabolic pathway. J. Biol. Chem.

294:11536-11548 (2019).

74

CHAPTER 3

SUPPLEMENTARY INFORMATION

Table S3.1 Nucleotide sequence of SeAR

>SeAR

ATGTTCGGTCTTATCGGTCATCTCACCAGTTTGGAGCAGGCCCGCGACGTTTCTCGCAGGATGGGC

TACGACGAATACGCCGATCAAGGATTGGAGTTTTGGAGTAGCGCTCCTCCTCAAATCGTTGATGAA

ATCACAGTCACCAGTGCCACAGGCAAGGTGATTCACGGTCGCTACATCGAATCGTGTTTCTTGCCG

GAAATGCTGGCGGCGCGCCGCTTCAAAACAGCCACGCGCAAAGTTCTCAATGCCATGTCCCATGCC

CAAAAACACGGCATCGACATCTCGGCCTTGGGGGGCTTTACCTCGATTATTTTCGAGAATTTCGAT

TTGGCCAGTTTGCGGCAAGTGCGCGACACTACCTTGGAGTTTGAACGGTTCACCACCGGCAATACT

CACACGGCCTACGTAATCTGTAGACAGGTGGAAGCCGCTGCTAAAACGCTGGGCATCGACATTACC

CAAGCGACAGTAGCGGTTGTCGGCGCGACTGGCGATATCGGTAGCGCTGTCTGCCGCTGGCTCGAC

CTCAAACTGGGTGTCGGTGATTTGATCCTGACGGCGCGCAATCAGGAGCGTTTGGATAACCTGCAG

GCTGAACTCGGCCGGGGCAAGATTCTGCCCTTGGAAGCCGCTCTGCCGGAAGCTGACTTTATCGTG

TGGGTCGCCAGTATGCCTCAGGGCGTAGTGATCGACCCAGCAACCCTGAAGCAACCCTGCGTCCTA

ATCGACGGGGGCTACCCCAAAAACTTGGGCAGCAAAGTCCAAGGTGAGGGCATCTATGTCCTCAAT

GGCGGGGTAGTTGAACATTGCTTCGACATCGACTGGCAGATCATGTCCGCTGCAGAGATGGCGCGG

CCCGAGCGCCAGATGTTTGCCTGCTTTGCCGAGGCGATGCTCTTGGAATTTGAAGGCTGGCATACT

AACTTCTCCTGGGGCCGCAACCAAATCACGATCGAGAAGATGGAAGCGATCGGTGAGGCATCGGTG

CGCCACGGCTTCCAACCCTTGGCATTGGCAATTTGA

Table S3.2 Primers used in this chapter

Primers

Sequence

SeAR-SLiCE-F

5’-AAATTTAAGGAGCGATCGCCATGTTCGGT

CTTATCGGTCATCTCACCAGTTTGGAGCAGG-3’

SeAR-SLiCE-R

5’-TCCATGTGCTGGCGTTCTCAAATTGCCAATG

CCAAGGGTTGGAAGCCGTGGCGCACCGATGCC-3’

pRSF-Stag-F

5’-GAACGCCAGCACATGGACTCG-3’

pRSF-Stag-rbs-R

5’-GGCGATCGCTCCTTAAATTTCGCAGCAGCGGTTTCTTTACCAGA-3’

SeARseq-F

5’-GGCATCGACATTACCCAAGCGACAG-3’

SeARseq-R

5’-CTGTCGCTTGGGTAATGTCGATGCC-3’

75

CHAPTER 3

Figure S3.1 SDS-PAGE of the protein sampled from each time point during fermentative alkane

production by (a) control strain and (b) ADH strain. The odd number lanes show the insoluble

fractions, while the even number lanes show the soluble fraction. Lane 1–2: 3 h (before IPTG

induction). Lane 3–4: 8 h. Lane 5–6: 24 h. Lane 7–8: 48 h. Lane 9–10: 72 h. Lane 11–12: 96 h.

Lane M: standard molecular weight. The predicted sizes of target proteins are: 26,300 (NpAD),

37,500 (SeAR), and 39,500 (His-tagged PsADH).

76

CHAPTER 3

77

CONCLUSION

CONCLUSION

In this study, the discovery of a fatty alcohol dehydrogenase, PsADH, was reported. This enzyme

was found to be originated from a soil isolate of Pantoea sp. 7-4 strain during the screening of 1tetradecanol-assimilating microorganisms. Heterologous expression of the PsADH gene in E. coli was

conducted, and the recombinant PsADH was purified for a series of biochemical characterizations,

including cofactors, optimal reaction conditions, kinetic parameters, and substrate specificity. PsADH

was found to be NAD+-dependent, with substrate specificity toward C6–C18 alcohols when catalyzing

alcohol dehydrogenation reaction. Co-expression of PsADH with an aldehyde-deformylating

oxygenase NpAD in E. coli resulted in the direct production of tridecane from 1-tetradecanol. By

optimizing the reaction conditions for the constructed E. coli strain, the conversion rate of the reaction

was increased to 52%. Furthermore, the alcohol-aldehyde-alkane synthetic route was applied to produce

C5–C17 alkanes from their corresponding alcohol substrates. Finally, the effect of PsADH on

fermentative alkane production was evaluated. This was achieved by co-expressing PsADH with NpAD

and an acyl-ACP reductase SeAR and by cultivating the transformed E. coli strains in a jar fermenter.

The introduction of PsADH led to the increase of alkanes and the decrease of fatty alcohol byproducts.

The alkanes produced included tridecane, pentadecane, and heptadecene, which are expected to be used

as drop-in biofuels.

78

ACKNOWLEDGEMENTS

ACKNOWLEDGEMENTS

This study is based on the work carried out from 2015 to 2017, and from 2019 to 2023 at the

Laboratory of Fermentation Physiology and Applied Microbiology, Division of Applied Life Sciences,

Graduate School of Agriculture, Kyoto University.

I would first like to appreciate Professor Jun Ogawa, who offers me the opportunities to study in

this laboratory. His warm encouragement and invaluable advice support me throughout the course of

this study and my life in Japan.

I would also like to express my sincere gratitude to Associate Professor Shigenobu Kishino, for

his constant support and encouragement throughout the course of this study. His guidance helps me

build up the ability to think scientifically and to solve problems when conducting research.

My gratitude also goes to Emeritus Professor Satomi Takahashi, Professor Makoto Ueda,

Associate Professors Makoto Hibi and Ryotaro Hara, Assistant Professors Akinori Ando, Michiki

Takeuchi and Hiroko Watanabe in Kyoto University, and Assistant Professor Yuta Sugiyama in Gunma

University, for their kind advice and valuable instructions.

This study would not have been completed without Dr. Natsumi Okada, Dr. Si-Bum Park, Dr.

Yoshimi Shimada, Dr. Tomoyo Okuda, Dr. Hideaki Nagano, Dr. Yoshie Fujiwara, Ms. Nahoko

Kitamura, and Ms. Atsuko Kitamura. I would like to express my deep thanks for their kind instructions

in experimental techniques, helpful advice, constant encouragement and unquestionable assistance.

I am grateful for the helpful suggestions and technical support provided by Dr. Masayoshi

Muramatsu, Mr. Shusei Obata, and Mr. Masakazu Ito, Toyota Motor Corporation, throughout the course

of this study.

Special thanks go to Mr. Satoshi Maruyama, for his great contribution to this study. Dr. Yuki

Nakatani and Mr. Kousuke Fujii also contributed valuable information as previous work of this study. I

would like to thank for their help.

I would like to thank Mr. Daichi Toyama, Mr. Takuma Morikawa, and Mr. Taiki Shiraishi, for

bringing me helpful support and exciting experience throughout my life in Japan.

I appreciate Dr. Brian King Himm Mo, Dr. Daniel Makoto Takeuchi, Dr. Chang-Yu Wu, Mr.

Makoto Sugimoto, and Mr. Kenta Nishitani, for discussing about my experiment results and sharing

their life experience with me. Their suggestions make me become a better researcher and a better person.

79

ACKNOWLEDGEMENTS

I would also like to thank Dr. Sakuntala Saijai, Dr. Azusa Saika, Mr. Ryota Nakatsuji, Mr. Riku

Usami, Mr. Wataru Shimada, Ms. Wakako Okada, Mr. Masafumi Horiki, Mr. Kensuke Ochi, Mr.

Takayuki Iihoshi, Ms. Mariko Fujikawa, Ms. You-Shan Tsai, Mr. Yusaku Ehara, Ms. Thimira-Akari

Yamamoto, Mr. Chun Wai Hui, Ms. Miu Kato, Mr. Ryota Kato, Mr. Shinya Nagahama, Mr. Kengo

Deguchi, Mr. Taku Mizutani, Mr. Liang-Wei Wei, Mr. Chi Hei Ip, Ms. Juo-Ying Chen, Mr. Shota

Kimoto, Mr. Naoki Ueda, Ms. Xinyang Liang, Ms. Julienne Hannelore Tolentino Borja, Ms. Anno

Katasho, Ms. Rina Kawarada, Ms. Honoka Kitagawa, Ms. Moe Itoh, Mr. Taito Tsukimata, Mr. HungCheng Lin, Mr. Yuichi Yoshimura, and all members of Laboratory of Fermentation Physiology and

Applied Microbiology, Kyoto University.

Finally, I offer my deepest gratitude to my mom and dad, for their never-ending support,

encouragement and understanding.

80

PUBLICATIONS

PUBLICATIONS

1. Yu-An Sui, Shigenobu Kishino, Satoshi Maruyama, Masakazu Ito, Masayoshi Muramatsu, Shusei

Obata, Jun Ogawa. Utilizing alcohol for alkane biosynthesis by introducing a fatty alcohol

dehydrogenase. Appl. Environ. Microbiol. 88(23):e01264-22 (2022).

2. Yu-An Sui, Satoshi Maruyama, Natsumi Okada, Masakazu Ito, Masayoshi Muramatsu, Shusei

Obata, Jun Ogawa, Shigenobu Kishino. Alkane production from fatty alcohols by the combined

reactions catalyzed by an alcohol dehydrogenase and an aldehyde-deformylating oxygenase. In

preparation.

3. Yu-An Sui, Satoshi Maruyama, Natsumi Okada, Masakazu Ito, Masayoshi Muramatsu, Shusei

Obata, Shigenobu Kishino, Jun Ogawa. Application of a fatty alcohol dehydrogenase PsADH to

fermentative production of alkanes. In preparation.

81

...