Akagi S., Nakajima C., Tanaka Y., Kurihara Y., 2018. Flow cytometry-based method for
rapid and high-throughput screening of hybridoma cells secreting monoclonal antibody.
J Biosci Bioeng; 125, 464–469. http://dx.doi: 10.1016/j.jbiosC II017.10.012
Arai M., Imazeki F., Sakai Y., Mikata R., Tada M., Seki N., Shimada H., Ochiai T.,
Yokosuka O., 2008. Analysis of the methylation status of genes up-regulated by the
demethylating agent, 5-aza-2'-deoxycytidine, in esophageal squamous cell carcinoma.
Oncol. Rep. 20, 405–412.
18
Balsa E., Marco R., Perales-Clemente E., Szklarczyk R., Calvo E., Landázuri M.O.,
Enríquez J.A., 2012. NDUFA4 is a subunit of complex IV of the mammalian electron
transport chain. Cell Metab. 16, 378–386. http://dx.doi: 10.1016/j.cmet.2012.07.015.
Boussouar F., Benahmed M., 2004. Lactate and energy metabolism in male germ cells.
Trends Endocrinol. Metab. 15, 345–350. http://dx.doi: 10.1016/j.cmet.2012.07.015.
Candas D., Qin L., Fan M., Li J.J., 2016. Experimental approaches to study
mitochondrial localization and function of a nuclear cell cycle kinase, Cdk1. J. Vis.
Exp. 108, 53417. http://dx.doi: 10.3791/53417.
Cotten M., Baker A., Saltik M., Wagner E., Buschle M., 1994. Lipopolysaccharide is a
frequent contaminant of plasmid DNA preparations and can be toxic to primary human
cells in the presence of adenovirus. Gene. Ther. 1, 239–246.
Esakky P., Hansen D.A., Drury A.M., Moley K.H., 2013. Molecular analysis of cell
type-specific gene expression profile during mouse spermatogenesis by laser
microdissection
and
qRT-PCR.
Reprod.
Sci.
20,
238–252.
http://dx.doi:
10.1177/1933719112452939.
Floyd B.J., Wilkerson E.M., Veling M.T., Minogue C.E., Xia C., Beebe E.T., Wrobel
R.L., Cho H., Kremer L.S., Alston C.L., Gromek K.A., Dolan B.K., et al., 2016.
Mitochondrial protein interaction mapping identifies regulators of respiratory chain
function. Mol. Cell 63, 621–632. http://dx.doi: 10.1016/j.molcel.2016.06.033
Fukuda R., Zhang H., Kim J.W., Shimoda L., Dang C., Semenza G.L., 2007. HIF-1
regulates cytochrome oxidase subunits to optimize efficiency of respiration in hypoxic
cells. Cell 129, 111–122.
Hüttemann M., Jaradat S., Grossman L.I., 2003. Cytochrome c oxidase of mammals
contains a testes-specific isoform of subunit VIb–The counterpart to testes-specific
19
cytochrome c? Mol. Reprod. Dev. 66, 8–16.
Kim D.S., Lee W.K., Park J.Y., 2018. Hypermethylation of normal mucosa of
esophagus-specifiC I is associated with an unfavorable prognosis in patients with
non-small cell lung cancer. Oncol. Lett. 16, 2409–2415. http://dx.doi:
10.3892/ol.2018.8915.
Kuwahara S., Ikei A., Taguchi Y., Tabuchi Y., Fujimoto N., Obinata M., Uesugi S.,
Kurihara Y., 2006. PSPC I, NONO, and SFPQ are expressed in mouse Sertoli cells and
may function as coregulators of androgen receptor-mediated transcription. Biol.
Reprod. 75, 352–359.
Li J.F., Li L., Sheen J., 2010. Protocol: A rapid and economical procedure for
purification of plasmid or plant DNA with diverse applications in plant biology. Plant
Methods 6, 1. http://dx.doi: 10.1186/1746-4811-6-1.
Li L., Wang R., He S., Shen X., Kong F., Li S., Zhao H., Lian M., Fang J., 2018. The
identification of induction chemo-sensitivity genes of laryngeal squamous cell
carcinoma and their clinical utilization. Eur. Arch. Otorhinolaryngol. 275, 2773–2781.
http://dx.doi: 10.1007/s00405-018-5134-x.
Liu G., Friggeri A., Yang Y., Park Y.J., Tsuruta Y., Abraham E., 2009. miR-147, a
microRNA that is induced upon Toll-like receptor stimulation, regulates murine
macrophage inflammatory responses. Proc. Natl. Acad. Sci. USA 106, 15819–15824.
http://dx.doi: 10.1073/pnas.0901216106.
Lucarelli G., Rutigliano M., Sallustio F., Ribatti D., Giglio A., Lepore Signorile M.,
Grossi V., Sanese P., Napoli A., Maiorano E., Bianchi C., Perego R.A., et al., 2018.
Integrated multi-omics characterization reveals a distinctive metabolic signature and
the role of NDUFA4L2 in promoting angiogenesis, chemoresistance, and
20
mitochondrial dysfunction in clear cell renal cell carcinoma. Aging 10, 3957–3985.
http://dx.doi: 10.18632/aging.101685.
McCarron J.G., Wilson C., Sandison M.E., Olson M.L., Girkin J.M., Saunter C.,
Chalmers S., 2013. From structure to function: Mitochondrial morphology, motion and
shaping in vascular smooth muscle. J. Vasc. Res. 50, 357–371. http://dx.doi:
10.1159/000353883.
Meng L., Yang X., Xie X., Wang M., 2019. Mitochondrial NDUFA4L2 protein
promotes the vitality of lung cancer cells by repressing oxidative stress. Thorac.
Cancer 10, 676-685. http://dx.doi: 10.1111/1759-7714.12984.
Milenkovic D., Blaza J.N., Larsson N.G., Hirst J., 2017. The enigma of the respiratory
chain supercomplex. Cell Metabolism 25, 765-776.
http://dx.doi.org/10.1016/j.cmet.2017.03.009
Mileykovskaya E., and Dowhan W., 2009. Cardiolipin membrane domains in
prokaryotes and eukaryotes. Biochim. Biophys. Acta 1788, 2084–2091.
https://doi.org/10.1016/j.bbamem.2009.04.003
Mileykovskaya E., and Dowhan W., 2014. Cardiolipin-dependent formation
of mitochondrial respiratory supercomplexes. Chem. Phys. Lipids 179, 42–48.
https://doi.org/10.1016/j.chemphyslip.2013.10.012
Piltti J., Bygdell J., Qu C., Lammi M.J., 2018. Effects of long-term low oxygen tension
in human chondrosarcoma cells. J. Cell Biochem. 119, 2320-2332. http://dx.doi:
10.1002/jcb.26394
Pitceathly R.D., Rahman S., Wedatilake Y., Polke J.M., Cirak S., Foley A.R., Sailer A.,
Hurles M.E., Stalker J., Hargreaves I., Woodward C.E., Sweeney M.G., et al., 2013.
NDUFA4 mutations underlie dysfunction of a cytochrome c oxidase subunit linked to
21
human neurological disease. Cell Rep. 3, 1795–805. http://dx.doi:
10.1016/j.celrep.2013.05.005.
Pitceathly R.D., Taanman J.W., 2018. NDUFA4 (renamed COXFA4) is a cytochrome-c
oxidase subunit. Trends Endocrinol. Metab. 29, 452–454. http://dx.doi:
10.1016/j.tem.2018.03.009.
Ramalho-Santos J., Amaral S., 2013. Mitochondria and mammalian reproduction. Mol.
Cell. Endocrinol. 379, 74–84. http://dx.doi: 10.1016/j.mce.2013.06.005.
Reed S.E., Staley E.M., Mayginnes J.P., Pintel D.J., Tullis G.E., 2006. Transfection of
mammalian cells using linear polyethylenimine is a simple and effective means of
producing recombinant adeno-associated virus vectors. J. Virol. Methods 138, 85–98.
Rees G.S., Ball, C., Ward H.L., Gee C.K., Tarrant G., Mistry Y., Poole S., Bristow A.F.,
1999. Rat interleukin 6: Expression in recombinant Escherichia coli, purification and
development of a novel ELISA. Cytokine 11, 95–103.
Riggs P.K., Angel J.M., Abel E.L., Digiovanni J., 2005. Differential gene expression in
epidermis of mice sensitive and resistant to phorbol ester skin tumor promotion. Mol
Carcinog 44, 122–136.
Sasaki K., Ono M., Takabe K., Suzuki A., Kurihara Y., 2018. Specific intron-dependent
loading of DAZAP1 onto the cox6c transcript suppresses pre-mRNA splicing efficacy
and induces cell growth retardation. Gene 657, 1–8. http://dx.doi:
10.1016/j.gene.2018.03.005.
Sinkler C.A., Kalpage H., Shay J., Lee I., Malek M.H., Grossman L.I., Hüttemann M.,
2017. Tissue- and condition-specific isoforms of mammalian cytochrome c oxidase
subunits: From function to human disease. Oxid. Med. Cell Longev. 1534056.
http://dx.doi: 10.1155/2017/1534056
22
Sova P., Feng Q., Geiss G., Wood T., Strauss R., Rudolf V., Lieber A., Kiviat N., 2006.
Discovery of novel methylation biomarkers in cervical carcinoma by global
demethylation and microarray analysis. Cancer Epidemiol. Biomarkers Prev. 15,
114–123.
Su A., Ra S., Li X., Zhou J., Binder S., 2013. Differentiating cutaneous squamous cell
carcinoma and pseudoepitheliomatous hyperplasia by multiplex qRT-PCR. Mod.
Pathol. 26, 1433–1437. http://dx.doi: 10.1038/modpathol.2013.82.
Tello D., Balsa E., Acosta-Iborra B., Fuertes-Yebra E., Elorza A., Ordóñez Á.,
Corral-Escariz M., Soro I., López-Bernardo E., Perales-Clemente E., Martínez-Ruiz A.,
Enríquez J.A., et al., 2011. Induction of the mitochondrial NDUFA4L2 protein by
HIF-1α decreases oxygen consumption by inhibiting Complex I activity. Cell Metab.
14, 768–779. http://dx.doi: 10.1016/j.cmet.2011.10.008.
Thayer K.A., Ruhlen R.L., Howdeshell K.L., Buchanan D.L., Cooke P.S., Preziosi D.,
Welshons W.V., Haseman J., vom Saal F.S., 2001. Altered prostate growth and daily
sperm production in male mice exposed prenatally to subclinical doses of
17-ethinyloestradiol. Hum. Reprod. 2001, 16, 988–996.
Velickovic L.J., Stefanovic V., 2014. Hypoxia and spermatogenesis. Int. Urol. Nephrol.
46, 887–94. http://dx.doi: 10.1007/s11255-013-0601-1.
Wenger R.H., Katschinski D.M., 2005. The hypoxic testis and post-meiotic expression
of PAS domain proteins. Semin. Cell Dev. Biol. 16, 547–53.
Wittig I., Braun H.P., Schägger H., 2006. Blue native PAGE. Nat. ProtoC I, 418–28.
Yue F., Cheng Y., Breschi A., Vierstra J., Wu W., Ryba T., Sandstrom R., Ma Z., Davis
C., Pope B.D., Shen Y., Pervouchine D.D., et al. (Mouse ENCODE Consortium)., 2014.
A comparative encyclopedia of DNA elements in the mouse genome. Nature 515,
23
355–64. http://dx.doi: 10.1038/nature13992.
Zhou J., Wang H., Lu A., Hu G., Luo A., Ding F., Zhang J., Wang X., Wu M., Liu Z.,
2002. A novel gene, NMES1, downregulated in human esophageal squamous cell
carcinoma. Int. J. Cancer 101, 311–316.
Zimmer A., Bouley J., Le Mignon M., Pliquet E., Horiot S., Turfkruyer M., Baron-Bodo
V., Horak F., Nony E., Louise A., Moussu H., Mascarell L. et al., 2012. A regulatory
dendritic cell signature correlates with the clinical efficacy of allergen-specific
sublingual immunotherapy. J. Allergy Clin. Immunol. 129, 1020–1030. http://dx.doi:
10.1016/j.jaci.2012.02.014.
Zong S., Wu M., Gu J., Liu T., Guo R., Yang M., 2018. Structure of the intact
14-subunit human cytochrome c oxidase. Cell Res. 28, 1026–1034. http://dx.doi:
10.1038/s41422-018-0071-1.
FIGURE LEGENDS
Fig. 1. Comparison of amino acid sequences and predicted secondary structure of
Coxfa4 isoforms. A, B) AA sequences of mouse Coxfa4 and its isoforms are compared
by CLUSTALW program. These secondary structures and homology comparisons are
estimated by the latest stereostructure of ETC C IV [Zong et al., 2018] and Jpred 4,
respectively. Predicted α-helices and β-sheets are marked as black and gray boxes are,
respectively. Blank boxes and blue arrows indicate cardiolipin binding sequence
deduced from the streostructure [Zong et al., 2018] and AAs of Coxfa4l3 which has
different chemical properties from the counterparts of Coxfa4, respectively. Red letters
indicate common AAs in the three proteins.
24
Fig. 2. Coxfa4l3 is a mitochondrial protein. A) Mitochondrial localization of
overexpressed Coxfa4l3 in HeLa cells. The cells were transfected with the
pCAGGS-Coxfa4l3-GST-myc vector. After 60 hrs of transfection, the cells were fixed
with 4% paraformaldehyde, permeabilized with cold methanol, and blocked with 5%
skim milk for 1 hr at room temperature. The anti-Coxfa4l3 Mab and Alexa Fluor 546
goat anti-mouse IgG (H+L) (Life Technologies) were used for primary and secondary
antibodies, respectively. After extensive washing, the cells were stained by MitoTracker
Green FM (200 nM) according to the manufacturer’s protocol. Then, the cells were
observed by fluorescent microscopy. B) Subcellular localization of exogenously
expressed Coxfa4l3. HeLa cells were transfected with the pCAGGS-Coxfa4l3-GST-myc
vector and cultured for 72 hrs. After subcellular fractionation as described in the
Materials and Methods, the fractions were subjected to SDS-PAGE and Western blot by
using Mabs for the fraction-specific markers. C) Subcellular localization of
endogenously expressed Coxfa4l3. The testis was collected from an adult BALB/cAJCl
male mouse, and subcellular fractionation was carried out as described in the Materials
and Methods. The protein samples were resolved by SDS-PAGE and subjected to
Western blot.
Fig. 3. Coxfa4, Coxfa4l2, and Coxfa4l3 expression in mouse tissue extracts. Tissue
preparation from adult BALB/cAJcl mice was carried out as described in the Materials
and Methods. The extracts were separated by SDS-PAGE and subjected to Western blot
by using anti-Coxfa4, anti-Coxfa4l2, and anti-Coxfa4l3 Mabs.
Fig. 4. Coxfa4 and Coxfa4l3 are accessory proteins of ETC CIV. Digitonin-treated
25
mitochondrial proteins from BALC/cAJCl male mouse testis were used for BN-PAGE.
After electrophoresis, the proteins were blotted onto polyvinylidene difluoride
membranes and analyzed by Western blot. Mt-Co1 and Cox6c are ETC CIV markers,
and Uqcrc2 and Ndufa9 are ETC CII and CI markers, respectively.
Fig. 5. Expression of Coxfa4 and Coxfa4l3 during mouse spermatogenesis. A) To
estimate the expression pattern of Coxfa4l3 during mouse spermatogenesis,
BALB/cAJCl male mouse testis extracts from the first wave of spermatogenesis were
analyzed. B) The schematic representation of the expressions of Coxfa4 and Coxfa4l3.
Shaded boxes and blank boxes indicate the cell types that expressed Coxfa4l3 and
Coxfa4, respectively.
SUPPLEMENTAL DATA LEGENDS
Fig. 1S. Validation of the established Mabs. To generate anti-Coxfa4, anti-Coxfa4l2, and
anti-Coxfa4l3 Mabs, the recombinant proteins expressed in E. coli listed in Table S2
were used. The proteins were immunized into BALB/cAJcl mice twice. Hybridoma
production and screening were essentially as described previously [Kuwahara et al.,
2006]. The cell extracts transfected with eukaryotic expression vectors for each protein
were analyzed to validate the specificities of established Mabs. Anti-αTubulin and GST
Mabs were used for transfection and loading controls, respectively.
Fig. 2S Expression of Coxfa4l3 in HeLa cells. Tello et al. 2011 reported that Coxfa4l2
was induced only in HeLa cells under hypoxic condition. Our data showed that the
protein was expressed in HeLa cells with and without hypoxic induction (Fig. 2SA).
26
RT-PCR analysis by using cDNA from the uninduced HeLa cells demonstrated that the
mRNA was expressed. The primers used were
αTubulin FW (exon3); ATGCCCGAGGGCACTACAC
αTubulin RV (exon 4); AGACGTTCCATGAGCAGCG
COXFA4L3 Fw (exon 2); ATGGCAGGAGCCAGTCTTGG
COXFA4L3 Rv (exon 5); TGGCTTAGAAGTCTGGCCGG.
Fig. 3S. Expression of Coxfa4, Coxfa4l3, and Cox6c in mouse sperm. The epididymis
of BALB/cAJCl male mice was minced in PBS buffer and placed for 10 mins at room
temperature. The sperm from the epididymis were collected by centrifugation and used
for Western blot. The Mabs used for Western blot were anti-Coxfa4, anti-Coxfa4l3, and
anti-Cox6c.
27
Table S1. Primers used for constructing eukaryotic expression vectors in this study
Coxfa4
Fw: ATAGGTACCATGCTCCGCCAGATCC
mouse
Rv: ATAGCTAGCGAAGTCTGGGCCTTC
Coxfa4l2
Fw: ACTGCTAGCATGTCCCCTATAC
mouse
Rv: CGTGAATTCTTAGAAGTCTGGC
Coxfa4l3
Fw: AGTGGTACCATGGGCGTTTTCCAG
mouse
Rv: ATAGCTAGCTCTGGTTGCCCTCCG
28
Table S3. Monoclonal antibodies used in this study
Antigen
Immunogen
Clone
Donor
amino acid position (species)
name
myeloma
Mt-Co1
recombinant 490-507 (mouse)
H7
P3U1
Cox6c
recombinant 13-88 (mouse)
#12
P3U1
Ndufa9
recombinant 315-377 (mouse)
3F2
SP2
Uqcr2
recombinant 367-454 (mouse)
1D11
SP2
GST
recombinant full-length (Schistosoma
1E10
P3U1
japonicum)
Coxfa4
recombinant 55-82 (mouse)
3C3
SP2
Coxfa4l2
recombinant 1-87 (mouse)
#23
SP2
Coxfa4l3
recombinant 52-83 (mouse)
5B11
SP2
...
論文の公開元へ
