論文の公開元へ

書き出し

Refer/BibIX

RIS

BibTeX

TSV

A RUNX-targeted gene switch-off approach modulates the BIRC5/PIF1-p21 pathway and reduces glioblastoma growth in mice

Yamamoto(Hattori), Etsuko 京都大学 DOI:10.14989/doctor.k24511

2023.03.23

概要

ARTICLE
https://doi.org/10.1038/s42003-022-03917-5

OPEN

A RUNX-targeted gene switch-off approach
modulates the BIRC5/PIF1-p21 pathway and
reduces glioblastoma growth in mice

1234567890():,;

Etsuko Yamamoto Hattori 1,2,7, Tatsuya Masuda2,7, Yohei Mineharu1, Masamitsu Mikami2,3, Yukinori Terada1,
Yasuzumi Matsui1,2, Hirohito Kubota3, Hidemasa Matsuo2, Masahiro Hirata 4, Tatsuki R. Kataoka4,
Tatsutoshi Nakahata5, Shuji Ikeda6, Susumu Miyamoto1, Hiroshi Sugiyama 6 ✉, Yoshiki Arakawa 1 ✉ &
Yasuhiko Kamikubo 2 ✉

Glioblastoma is the most common adult brain tumour, representing a high degree of
malignancy. Transcription factors such as RUNX1 are believed to be involved in the malignancy of glioblastoma. RUNX1 functions as an oncogene or tumour suppressor gene with
diverse target genes. Details of the effects of RUNX1 on the acquisition of malignancy in
glioblastoma remain unclear. Here, we show that RUNX1 downregulates p21 by enhancing
expressions of BIRC5 and PIF1, conferring anti-apoptotic properties on glioblastoma. A gene
switch-off therapy using alkylating agent-conjugated pyrrole-imidazole polyamides, designed
to ﬁt the RUNX1 DNA groove, decreased expression levels of BIRC5 and PIF1 and induced
apoptosis and cell cycle arrest via p21. The RUNX1-BIRC5/PIF1-p21 pathway appears to
reﬂect refractory characteristics of glioblastoma and thus holds promise as a therapeutic
target. RUNX gene switch-off therapy may represent a novel treatment for glioblastoma.

1 Department of Neurosurgery, Graduate School of Medicine, Kyoto University; Kyoto City, Kyoto 606-8507, Japan. 2 Department of Human Health Sciences,
Graduate School of Medicine, Kyoto University; Kyoto City, Kyoto 606-8507, Japan. 3 Department of Pediatrics, Graduate School of Medicine, Kyoto
University; Kyoto City, Kyoto 606-8507, Japan. 4 Department of Diagnostic Pathology, Kyoto University Hospital; Kyoto City, Kyoto 606-8507, Japan. 5 Drug
Discovery Technology Development Ofﬁce, Center for iPS Cell Research and Application (CiRA), Kyoto University; Kyoto City, Kyoto 606-8507, Japan.
6 Department of Chemistry, Graduate School of Science, Kyoto University; Kyoto City, Kyoto 606-8502, Japan. 7These authors contributed equally: Etsuko
Yamamoto Hattori, Tatsuya Masuda. ✉email: sugiyama.hiroshi.3s@kyoto-u.ac.jp; yarakawa@kuhp.kyoto-u.ac.jp; kamikubo.yasuhiko.7u@kuhp.kyoto-u.ac.jp

COMMUNICATIONS BIOLOGY | (2022)5:939 | https://doi.org/10.1038/s42003-022-03917-5 | www.nature.com/commsbio

1

ARTICLE

COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-022-03917-5

G

lioblastoma is the most common adult brain tumour, but
has a quite poor 2-year survival rate of about 30%,
representing a high degree of malignancy1,2. Although the
current standard of care for glioblastoma includes surgical removal
of the tumour to the greatest extent possible, radiotherapy, and
treatment with anticancer agents such as temozolomide1, chemotherapeutic agents that are signiﬁcantly effective have yet to be
identiﬁed, and efﬁcacious treatment methods are strongly desired.
One factor that contributes to the difﬁculty of treating glioblastoma
is the high degree of heterogeneity of this tumour. Although four
molecular subtypes of glioblastoma have been proposed according
to the type of genetic mutation, such as proneural, neural, classical,
and mesenchymal2, the diversity of several subtypes within a single
tumour makes clear classiﬁcation difﬁcult. Genetic mutations to a
transcription factor in glioblastoma are known to be involved in
malignant transformation. Carro et al. reported runt-related
transcriptional factor 1 (RUNX1) as a transcription factor
involved in the malignant phenotype of glioblastomas3. RUNX1 is
a member of the RUNX family of transcription factors (RUNX1,
RUNX2 and RUNX3), and is known to inﬂuence the malignancy
of many neoplasms, including leukaemia, and to act as an oncogene or tumour suppressor gene with diverse functions depending
on the tumour4.
The RUNX family regulates the transcription of downstream
genes by recognising and targeting a common core consensus
DNA-binding sequence, 5′-TGTGGT-3′5. We have already indicated that the RUNX family is required for the maintenance and
progression of acute myeloid leukaemia (AML) and cluster
inhibition of the RUNX family could represent a new therapeutic
strategy for AML6. In addition, we have developed a pyrroleimidazole (PI) polyamide, Chb-M’, to bind to this DNA-binding
sequence and reduce the transcriptional activity of RUNX, and
have reported that RUNX family gene switch-off exerts tumoursuppressive effects in AML and solid tumours such as gastric
cancer6,7. However, the genes and pathways targeted by the
RUNX family to maintain tumour malignancy vary, and the
details remain unclear.
Here, we hypothesised that interference by this RUNX family
might have anti-tumour effects in refractory glioblastoma. By
investigating those genes for which expression is altered via the
interference of the RUNX family, we revealed signalling pathways
needed to maintain malignancy in glioblastoma.
Results
RUNX is highly expressed in glioblastoma. To determine
expression levels of RUNX1 in glioblastoma tissues, we analysed
GSE111260 microarray data set in comparison with normal brain
and low-grade glioma tissue. RUNX1 expression was signiﬁcantly
higher in primary glioblastomas than in normal tissue or grade 2
low-grade glioma (p < 0.0001) (Fig. 1a). Pan-RUNX, representing
total expression levels of RUNX1, RUNX2 and RUNX3, was also
predominantly high in primary GBM (p < 0.0001) (Supplementary Fig. 1a). Higher expressions of RUNX families were associated with higher grade of glioma. We conﬁrmed that RUNX
family members were highly expressed in glioblastoma cell lines
(Fig. 1b). In addition, we evaluated the expression and survival of
RUNX1 in the TCGA dataset for glioblastoma. Of the 167 cases
for which data on RUNX1 expression level and survival were
available, we categorised that half of the cases with the highest
RUNX1 expression as the “High” group and that half of the cases
with the lowest RUNX1 expression as the “Low” group, then
compared survival rates. The High group showed a signiﬁcantly
poorer survival rate (p = 0.0447) (Fig. 1c). An association
between RUNX1 and maintenance of glioblastoma malignancy
was thus estimated to be present.
2

The same survival analyses were also performed for panRUNX, RUNX2 and RUNX3. While pan-RUNX showed a poorer
survival rate in the high group, like RUNX1 (p = 0.0214), no
signiﬁcant differences in survival were apparent between high and
low expression groups for either RUNX2 or RUNX3 (p = 0.494,
p = 0.868) (Supplementary Fig. 1b–d). Taken together, RUNX1
was suggested to represent a crucial component in the
maintenance of glioblastoma malignancy.
Switching off RUNX1 reduces cell growth. We have developed a
drug, Chb-M’, consisting of a pyrrole-imidazole (PI) polyamide in
which the sequence recognises the RUNX-binding consensus site
(5′-TGTGGT-3′ and 5′-TGCGGT-3′), conjugated to the alkylating agent chlorambucil6. This drug uses a gene switch-off method
to repress the transcription of RUNX target genes by preventing
RUNX from binding to RUNX-binding consensus sites. We have
already shown that this drug has anti-tumour effects on multiple
cancer cell lines and that the effect is likely to be more effective
against wild-type TP536–8. First, we checked for the presence of
TP53 mutations in four glioblastoma cell lines (A172, KALS-1,
LN229 and T98G) by Sanger sequencing, revealing that all lines
contained TP53 mutations (Supplementary Table 1). These cell
lines were incubated with Chb-M′ at 0.5 µM or 2 µM, and all cell
lines showed concentration-dependent inhibition of cell proliferation by dimethyl sulphoxide (DMSO) (Fig. 1d). Chb-S was
also prepared, as a PI polyamide conjugated with chlorambucil in
the same manner as Chb-M’ and containing a sequence that does
not recognise RUNX-binding consensus sites6. Comparing glioblastoma cell line responses to Chb-M’, Chb-S and Chb, Chb-M’
achieved 50% inhibition of proliferation for glioblastoma cell lines
at concentrations of around 1 µM after 72 h of treatment,
representing a lower concentration than those required by Chb-S
and Chb (Fig. 1e and Supplementary Table 2). We also directly
compared the effects of Chb-S and Chb-M’ by cell proliferation
assay and found that Chb-M′ had a signiﬁcant cell-suppressive
effect (Supplementary Fig. 2a). These results suggest that the
reduction in the transcriptional activity of RUNX1 achieved by
Chb-M′, rather than simple anticancer effects of chlorambucil,
was involved in the suppression of glioblastoma cell line growth.
Apoptosis assays showed that apoptosis was the reason for the
inhibition of cell growth caused by Chb-M′ administration
(Fig. 1f and Supplementary Fig. 2b). Cell cycle assay showed an
increase in the number of cells in the G2/M phase (Supplementary Fig. 2c, d) and cyclin A, B and Cdc25 were decreased
(Supplementary Fig. 2e), indicating G2/M arrest9,10.
Overall, our results suggested that Chb-M′ has tumoursuppressive effects in glioblastoma via apoptosis-mediated cell death.
Mechanism of Chb-M′ in glioblastoma. An apoptosis array was
performed using four glioblastoma cell lines to search for genes
associated with apoptosis by Chb-M′. A172, KALS-1, LN229, and
T98G showed different trends in various genes. The A172, KALS1, and LN229 cell lines showed clear increases in p21 and
decreases in BIRC5, while the T98G line displayed a lower degree
of variability overall, with noticeably lower expression of Bcl-x
(Supplementary Fig. 3a–c). These trends were also conﬁrmed by
western blots (Fig. 1g, Supplementary Fig. 3d, e), and reverse
transcription polymerase chain reaction (RT-PCR) conﬁrmed
that expressions of these genes varied at the mRNA level in A172
and KALS-1 (Fig. 1h). LN229 showed a similar increase in p21,
and BIRC5 tended to decrease in the early time phase (Supplementary Fig. 3f). ...

論文の公開元へ

この論文で使われている画像

参考文献

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

Stupp, R. et al. Radiotherapy plus concomitant and adjuvant temozolomide for

glioblastoma. N. Engl. J. Med. 352, 987–996 (2005).

Gilbert, M. R. et al. Dose-dense temozolomide for newly diagnosed

glioblastoma: a randomized phase III clinical trial. J. Clin. Oncol. 31,

4085–4091 (2013).

Carro, M. S. et al. The transcriptional network for mesenchymal

transformation of brain tumours. Nature 463, 318–325 (2010).

Ito, Y., Bae, S. C. & Chuang, L. S. The RUNX family: developmental regulators

in cancer. Nat. Rev. Cancer 15, 81–95 (2015).

Bowers, S. R., Calero-Nieto, F. J., Valeaux, S., Fernandez-Fuentes, N. &

Cockerill, P. N. Runx1 binds as a dimeric complex to overlapping Runx1 sites

within a palindromic element in the human GM-CSF enhancer. Nucleic Acids

Res. 38, 6124–6134 (2010).

Morita, K. et al. Genetic regulation of the RUNX transcription factor family

has antitumor effects. J. Clin. Invest. 127, 2815–2828 (2017).

Mitsuda, Y. et al. RUNX1 positively regulates the ErbB2/HER2 signaling

pathway through modulating SOS1 expression in gastric cancer cells. Sci. Rep.

8, 6423 (2018).

Morita, K. et al. Autonomous feedback loop of RUNX1-p53-CBFB in acute

myeloid leukemia cells. Sci. Rep. 7, 16604 (2017).

Lee, D. et al. ER Stress induces cell cycle arrest at the G2/M phase through

eIF2α phosphorylation and GADD45α. Int. J. Mol. Sci. 20, https://doi.org/10.

3390/ijms20246309 (2019).

Tang, Q. et al. Withaferin A triggers G2/M arrest and intrinsic apoptosis in

glioblastoma cells via ATF4-ATF3-CHOP axis. Cell Prolif. 53, e12706 (2020).

Erwin, G. S. et al. Synthetic transcription elongation factors license

transcription across repressive chromatin. Science 358, 1617–1622 (2017).

Trauger, J. W., Baird, E. E. & Dervan, P. B. Recognition of DNA by designed

ligands at subnanomolar concentrations. Nature 382, 559–561 (1996).

Altieri, D. C. Survivin, versatile modulation of cell division and apoptosis in

cancer. Oncogene 22, 8581–8589 (2003).

Varughese, R. K. & Torp, S. H. Survivin and gliomas: a literature review.

Oncol. Lett. 12, 1679–1686 (2016).

Zhang, S., Zhang, C., Song, Y., Zhang, J. & Xu, J. Prognostic role of survivin in

patients with glioma. Med. (Baltim.) 97, e0571 (2018).

Aloyz, R. et al. Imatinib sensitizes CLL lymphocytes to chlorambucil.

Leukemia 18, 409–414 (2004).

Hoi, C. S. et al. Runx1 directly promotes proliferation of hair follicle stem cells

and epithelial tumor formation in mouse skin. Mol. Cell Biol. 30, 2518–2536

(2010).

Scheitz, C. J. & Tumbar, T. New insights into the role of Runx1 in epithelial

stem cell biology and pathology. J. Cell Biochem 114, 985–993 (2013).

Lee, J. et al. Runx1 and p21 synergistically limit the extent of hair follicle stem

cell quiescence in vivo. Proc. Natl Acad. Sci. USA 110, 4634–4639 (2013).

Sparks, M. A., Singh, S. P., Burgers, P. M. & Galletto, R. Complementary roles of

Pif1 helicase and single stranded DNA binding proteins in stimulating DNA

replication through G-quadruplexes. Nucleic Acids Res. 47, 8595–8605 (2019).

Gagou, M. E. et al. Human PIF1 helicase supports DNA replication and cell

growth under oncogenic-stress. Oncotarget 5, 11381–11398 (2014).

Gagou, M. E. et al. Suppression of apoptosis by PIF1 helicase in human tumor

cells. Cancer Res. 71, 4998–5008 (2011).

Raskatov, J. A., Szablowski, J. O. & Dervan, P. B. Tumor xenograft uptake of a

pyrrole-imidazole (Py-Im) polyamide varies as a function of cell line grafted. J.

Med. Chem. 57, 8471–8476 (2014).

Bae, S. C., Kolinjivadi, A. M. & Ito, Y. Functional relationship between p53

and RUNX proteins. J. Mol. Cell Biol. 11, 224–230 (2019).

Suwala, A. K. et al. Glioblastomas with primitive neuronal component harbor

a distinct methylation and copy-number proﬁle with inactivation of TP53,

PTEN, and RB1. Acta Neuropathol. 142, 179–189 (2021).

Ozaki, T., Nakagawara, A. & Nagase, H. RUNX family participates in the

regulation of p53-dependent DNA damage response. Int J. Genomics 2013,

271347 (2013).

Tang, L., Ling, X., Liu, W., Das, G. M. & Li, F. Transcriptional inhibition of

p21WAF1/CIP1 gene (CDKN1) expression by survivin is at least partially

p53-dependent: evidence for survivin acting as a transcription factor or cofactor. Biochem Biophys. Res. Commun. 421, 249–254 (2012).

Xu, Q. et al. Overexpression of KLF4 promotes cell senescence through

microRNA-203-survivin-p21 pathway. Oncotarget 7, 60290–60302 (2016).

ARTICLE

29. Ullah, Z., de Renty, C. & DePamphilis, M. L. Checkpoint kinase 1 prevents cell

cycle exit linked to terminal cell differentiation. Mol. Cell Biol. 31, 4129–4143

(2011).

30. Lapenna, S. & Giordano, A. Cell cycle kinases as therapeutic targets for cancer.

Nat. Rev. Drug Discov. 8, 547–566 (2009).

31. Barr, A. R. et al. DNA damage during S-phase mediates the proliferationquiescence decision in the subsequent G1 via p21 expression. Nat. Commun.

8, 14728 (2017).

32. Aasland, D. et al. Temozolomide induces senescence and repression of DNA

repair pathways in glioblastoma cells via activation of ATR-CHK1, p21, and

NF-κB. Cancer Res. 79, 99–113 (2019).

33. Zhang, Y. & Hunter, T. Roles of Chk1 in cell biology and cancer therapy. Int.

J. Cancer 134, 1013–1023 (2014).

34. Li, Y. et al. Silencing of survivin expression leads to reduced proliferation and

cell cycle arrest in cancer cells. J. Cancer 6, 1187–1194 (2015).

35. Morita, K. et al. RUNX transcription factors potentially control E-selectin

expression in the bone marrow vascular niche in mice. Blood Adv. 2, 509–515

(2018).

Acknowledgements

This research was supported by the Platform Project for Supporting Drug Discovery and

Life Science Research (Basis for Supporting Innovative Drug Discovery and Life Science

Research (BINDS)) grant number “19am0101101j0003”; Basic Science and Platform

Technology Program for Innovative Biological Medicine from the Japan Agency for

Medical Research and Development grant number 15am0301005h0002; grants from the

International Joint Usage/Research Center, the Institute of Medical Science, and the

University of Tokyo, and a Grant-in-Aid for Scientiﬁc Research (KAKENHI), grant

number 17H03597, 19K22685, 19K09505, and 22H03186. We would like to thank Dr. H.

Miyoshi (RIKEN BRC) for kindly providing the lentivirus vector encoding CSIV-TRERfA-UbC-KT and Dr. Jeanmougin for providing GSE111260.

Author contributions

E.H., Y.A., H.S., and Y.K. designed the study. E.H., M.M., Y.M., T.M., H.M., M.H., T.K.,

T.N., and S.I. performed experiments and data analyses. Y.M., Y.T., H.K., S.A., and S.M.

performed analyses of gene data. E.H. and Y.A. wrote the manuscript. All authors read

and approved the ﬁnal manuscript.

Competing interests

The authors have declared that no competing interests exist within this study.

Additional information

Supplementary information The online version contains supplementary material

available at https://doi.org/10.1038/s42003-022-03917-5.

Correspondence and requests for materials should be addressed to Hiroshi Sugiyama,

Yoshiki Arakawa or Yasuhiko Kamikubo.

Peer review information Communications Biology thanks Nehal Thakor, Jianqiang Wu

and the other, anonymous, reviewer(s) for their contribution to the peer review of this

work. Primary Handling Editors: Georgios Giamas and Christina Karlsson

Rosenthal. Peer reviewer reports are available.

Reprints and permission information is available at http://www.nature.com/reprints

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in

published maps and institutional afﬁliations.

Open Access This article is licensed under a Creative Commons

Attribution 4.0 International License, which permits use, sharing,

adaptation, distribution and reproduction in any medium or format, as long as you give

appropriate credit to the original author(s) and the source, provide a link to the Creative

Commons license, and indicate if changes were made. The images or other third party

material in this article are included in the article’s Creative Commons license, unless

indicated otherwise in a credit line to the material. If material is not included in the

article’s Creative Commons license and your intended use is not permitted by statutory

regulation or exceeds the permitted use, you will need to obtain permission directly from

the copyright holder. To view a copy of this license, visit http://creativecommons.org/

licenses/by/4.0/.

COMMUNICATIONS BIOLOGY | (2022)5:939 | https://doi.org/10.1038/s42003-022-03917-5 | www.nature.com/commsbio

Supplementary Information

A RUNX-targeted gene switch-off approach modulates the

BIRC5/PIF1-p21 pathway and reduces glioblastoma growth in mice

Etsuko Yamamoto Hattori1,2, Tatsuya Masuda2, Yohei Mineharu1, Masamitsu Mikami2,3,

Yukinori Terada1, Yasuzumi Matsui1,2, Hirohito Kubota3, Hidemasa Matsuo2, Masahiro

Hirata4, Tatsuki R. Kataoka4, Tatsutoshi Nakahata5, Shuji Ikeda6, Susumu Miyamoto1,

Hiroshi Sugiyama6*, Yoshiki Arakawa1*, Yasuhiko Kamikubo2*

Department of Neurosurgery, Graduate School of Medicine, Kyoto University; Kyoto

City, Kyoto 606-8507, Japan

Department of Human Health Sciences, Graduate School of Medicine, Kyoto

University; Kyoto City, Kyoto 606-8507, Japan

Department of Pediatrics, Graduate School of Medicine, Kyoto University; Kyoto

City, Kyoto 606-8507, Japan

Department of Diagnostic Pathology, Kyoto University Hospital; Kyoto City, Kyoto

606-8507, Japan

Drug Discovery Technology Development Office, Center for iPS Cell Research and

Application (CiRA), Kyoto University; Kyoto City, Kyoto 606-8507, Japan

Department of Chemistry, Graduate School of Science, Kyoto University; Kyoto City,

Kyoto 606-8502, Japan

These authors contributed equally: Etsuko Yamamoto Hattori, Tatsuya Masuda.

*Corresponding authors

Hiroshi Sugiyama, E-mail: sugiyama.hiroshi.3s@kyoto-u.ac.jp

Yoshiki Arakawa, E-mail: yarakawa@kuhp.kyoto-u.ac.jp

Yasuhiko Kamikubo, E-mail: kamikubo.yasuhiko.7u@kuhp.kyoto-u.ac.jp

Supplementary Figure 1: Expression level and difference in survival rate of RUNX

family.

a, Relative expression level of pan-RUNX to GAPDH for normal brain and each grade

of glioma. Data were retrieved from GSE 111260. The box shows interquartile range.

Upper border shows the upper quartile, middle line shows the median and lower border

shows the lower quartile. Top and bottom lines show maximum and minimum values. P

values were analysed by one-way ANOVA.

b-d, Survival curve based on glioblastoma pan-RUNX (b), RUNX2 (c) and RUNX3 (d)

expression levels.

Numbers of subjects in the pan-RUNX high (top one-third) and low (bottom one-third)

groups are 55 and 55, and numbers in RUNX2 and RUNX3 high (top half) and low

(bottom half) groups are 83 and 84, respectively. P-values were calculated by log-rank

testing. Data were retrieved from The Cancer Genome Atlas (TCGA). The datasets are

available in GDC TCGA Glioblastoma repository, https://gdc-hub.s3.us-east1.amazonaws.com/latest/TCGA-GBM.htseq_fpkm.tsv.gz.

Supplementary Figure 2: Anti-tumour effects of Chb-M'.

a, Growth curves of GBM cells treated with Chb-M’ 0.5 µM and Chb-S 0.5 µM. N = 3.

b, Representative figures for apoptosis status as determined from A172, KALS-1,

LN229 and T98G cell lines cultured in the presence of 5 µM of Chb-M' for 48 h.

c-d, Cell cycle arrest caused by Chb-M'. A172, KALS-1, LN229 and T98G cell lines

were cultured as in b. C shows the percentage cell count for each cell cycle and d is the

representative figure. n = 3.

e, Expression levels of genes associated with cell cycle arrest detected by

immunoblotting. Cells were treated with 0.5 µM or 1 µM of Chb-M' or DMSO for 48 h,

then cell lysates were prepared and immunoblotted.

Data represent mean ± 95%CI. *p < 0.05, **p < 0.01, ***p < 0.001, by two-tailed

Student’s t-test.

Supplementary Figure 3: Selection of genes that fluctuate in relation to Chb-M'.

a-c, Relative densitometric quantification of apoptosis array spots in Chb-M'-treated

GBM cells compared to the control (b: A172, KALS-1 and LN229; c: T98G). Cells

were treated with DMSO or 1 µM Chb-M' for 48 h, then lysed for the apoptosis array.

Each receptor was spotted in duplicate. A shows the immunoblot image. Blue, red and

green squares indicate spots of BIRC5, p21 and Bcl-x, respectively.

d, Immunoblotting of each GBM cell line treated with 0.5 µM or 1 µM Chb-M' or

DMSO for 48 h. The numbers under the blot are normalized values for GAPDH and

DMSO-treated cells.

e, Protein expression levels of the immunoblotting were quantitatively measured and

corrected with GAPDH. Values are normalized to DMSO-treated cells. Cells were

treated as in d. n = 3.

f, Gene expression levels of real-time RT-PCR. LN229 cells were treated with 1 µM of

Chb-M’ 1 µM of Chb-S or DMSO for 3, 9 h, then total RNA was prepared. Values of

Chb-M’ and Chb-S are normalized to DMSO-treated cells. n = 3.

g, Gene expression levels of real-time RT-PCR. Cells were treated with 1 µM of ChbM’ or 1 µM of Chb-S or DMSO for 48 h, then total RNA was prepared. Values of ChbM’ and Chb-S are normalized to DMSO-treated cells. KALS-1 treated Chb-M’: N = 4,

other samples: n = 3.

Data represent mean ± 95% confidence interval (CI). *p < 0.05, **p < 0.01, ***p <

0.001, by Welch’s t-test (e), two-tailed Student’s t-test (f, g).

Supplementary Figure 4: Apoptosis and cell cycle arrest are induced by decreased

expression of RUNX1.

a, Representative figures of apoptosis status determined in four glioblastoma cell lines

transduced with control or RUNX1 shRNAs. Cells were treated with 5 µM of

doxycycline for 4 days (LN229 and T98G) or 6 days (A172 and LN229).

b, Representative figures of cell cycle assay determined in four glioblastoma cell lines

transduced with control or RUNX1 shRNAs. All cells were treated with 5 µM of

doxycycline for 4 days.

c-d, Immunoblotting of each GBM cell line transduced with RUNX1 shRNAs.

Sh_RUNX1 cells were cultured in the presence of 5 µM of doxycycline and control cells

were cultured in the absence of doxycycline. The numbers under the blot are normalized

values for GAPDH and control cells.

e, Protein expression levels of the immunoblotting were quantitatively measured and

corrected with GAPDH. Values are normalized to doxycycline-untreated cells. Cells

were treated as in c and d. n = 3.

f, Immunoblotting of each GBM cell line transduced with control or RUNX1 shRNAs.

Cells were cultured in the presence of 5 µM of doxycycline.

Data represent mean ± 95%CI. *p < 0.05, **p < 0.01, by Welch’s t-test.

Supplementary Figure 5: Genes involved in apoptosis and cell cycle arrest are

altered by Chb-M'.

a, Microarray results for 1 µM of Chb-M' against DMSO are shown in a volcano plot.

BIRC5 and p21 are indicated by red dots. n = 3.

b-c, Microarray results were subsequently analysed by GSEA. B shows Chb-M'-treated

samples were enriched in p53 and apoptosis-related genes. C shows Chb-M'-treated

samples depleted for G2/M cell cycle-related genes.

Supplementary Figure 6: Apoptosis and cell cycle arrest are induced by decreased

expression of BIRC5

a, Relative expression levels of BIRC5 normalized to GAPDH for normal brain and

each grade of glioma. Data were retrieved from GSE 111260. The box shows

interquartile range. Upper border shows the upper quartile, middle line shows the

median and lower border shows the lower quartile. Top and bottom lines indicate

maximum and minimum values.

b, Clustering analysis to assess correlations between the RUNX family and BIRC5. The

upper belt shows the grade of glioma. Data were retrieved from GSE 111260 microarray

datasets.

c, Immunoblotting of each GBM cell line transduced with control or BIRC5 shRNAs.

Control (sh_Luc) and sh_BIRC5 cells were cultured in the presence of 5 µM of

doxycycline.

d, Dose-response curves of A172 and KALS-1 cell lines after treatment with YM155 at

72 h. IC50 values of YM155 are shown in table S3. IC50 values were fit to data

calculated using GraphPad Prism 5 software. n = 3.

e, BIRC5 depression induces apoptosis. Non-depressed and BIRC5-depressed A172 and

KALS-1 cell lines were treated in the presence of 5 µM of doxycycline for 4 days. Left

shows the percentage of Annexin V+ cells. Right shows a representative figure of

apoptosis status. The line in the centre of the rhombus indicates the mean value, and the

vertical width indicates the 95%CI. n = 3.

f, BIRC5 depression induces G2/M arrest. Left shows the percentage of cells in each

cell cycle. Right shows a representative figure. Non-depressed and BIRC5-depressed

A172 and KALS-1 cells were treated as in e. n = 3.

g, Immunoblotting of RUNX1-depleted A172 cells with restored BIRC5 expression. The

indicated cells were cultured in the presence of 5 µM of doxycycline.

h, Protein expression levels of the immunoblotting were quantitatively measured and

corrected with GAPDH. Values are normalized to doxycycline-untreated cells. Nondepressed and BIRC5-depressed cells were cultured in the presence of 5 µM of

doxycycline for 5 days. n = 3.

Data represent mean ± 95%CI. **p < 0.01, ***p < 0.001, by one-way ANOVA (a),

two-tailed Student’s t-test (e and f), Welch’s t-test. (h).

Supplementary Figure 7: Apoptosis and cell cycle arrest are induced by

overexpression of p21 or suppressed PIF1.

a, Growth curves (left) and immunoblotting (right) of A172 and KALS-1 cell lines

transduced with control (Empty vector) or with p21 overexpression in the presence of 5

µM of doxycycline. n = 3.

b, Immunoblotting (left) and relative protein expression levels (right) of p21

overexpression cells. Expressions of the RUNX family, BIRC5 and PIF1 were

unaffected by p21 overexpression. Non-depressed and BIRC5-depressed cells were

cultured in the presence of 5 µM of doxycycline for 4 days. The numbers under the blot

are normalized values for GAPDH and cells cultured without doxycycline. Protein

expression levels were quantitatively measured and corrected with GAPDH. Values are

normalized to doxycycline-untreated cells.

c, Immunoblotting for RUNX1- or BIRC5-depleted A172 cells suppressed p21

expression. The indicated cells were cultured in the presence of 5 µM of doxycycline.

d, Overexpression of p21 induced G2/M arrest. Non-overexpressing and p21overexpressing A172 and KALS-1 lines were treated in the presence of 5 µM of

doxycycline for 6 days. Left shows percentages of cells in each cell cycle. Right shows

a representative figure. n = 3.

e, Microarray results were subsequently analysed by GSEA. Chb-M'-treated samples

depleted for DNA replication-related genes.

f, Expression levels of genes when PIF1 was repressed as detected by RT-PCR. PIF1

inhibition did not change CHK1 expression levels in A172 or KALS-1 cell lines. Cells

were cultured in the presence of PIF1 siRNA for 3 days. n = 4.

Data represent mean ± 95%CI. *p < 0.05, **p < 0.01, ***p < 0.001, by two-tailed

Student’s t-test (a, d), Welch’s t-test (b, f).

Supplementary Figure 8: Chb-M' is effective for intracranial tumour in vivo.

a, Schematic representation of treatment schedule in xenotransplanted mice.

b, Pathological samples of normal brain and intracranial tumour treated with FITClabelled Chb-M' and DMSO immunostained with isotype-matched control antibody.

Scale bars: 50 µm.

c, Pathological samples of subcutaneous tumour treated with FITC-labelled Chb-M' and

DMSO immunostained with goat anti-FITC antibody (upper) and isotype-matched

control antibody (middle). Scale bars: 50 µm. HE; Hematoxylin Eosin

d,e, Pathological samples of intracranial tumour(d) and subcutaneous tumour(e) treated

with FITC-labelled Chb-M' and DMSO immunostained with cleaved caspase3 antibody

(upper), TUNEL assay (middle) and Ki-67 antibody (lower). Scale bars: 50 µm.

Supplementary Figure 9 (Unedited Gels)

Supplementary Table 1. TP53 mutations in GBM cell lines

Cell line

Exon 4

Exon 6

Exon 7

Exon 10

Exon 11

c.215 C>G

A172

p.P72R

COSM3766190

c.722C>T

KALS-1

p.S241F

COSM10812

c.293 C>T

LN229

p.P98L

COSM44681

c.711G>A

T98G

p.M237I

COSM10834

Supplementary Table 2. Half maximal inhibitory concentration (IC50) values for

chlorambucil (Chb), Chb-M' and Chb-S and chlorambucil (Chb)

A172

IC50 (µM)

48 h

72 h

96 h

Chb

29.35

> 50

Chb-M'

25.71

2.47

0.85

Chb-S

25.73

17.75

2.51

IC50 (µM)

48 h

72 h

96 h

Chb

> 50

Chb-M'

14.88

1.49

0.15

Chb-S

26.67

2.48

2.63

IC50 (µM)

48 h

72 h

96 h

Chb

29.35

> 50

Chb-M'

11.13

3.35

1.39

Chb-S

> 50

KALS-1

LN229

T98G

IC50 (µM)

48 h

72 h

96 h

Chb

> 50

Chb-M'

1.96

0.85

0.34

Chb-S

> 50

25.60

> 50

Supplementary Table 3. IC50 of YM155

IC50 (nM)

48 h

72 h

96 h

A172

420.3

102.0

66.3

KALS-1

103.0

50.9

51.9

Supplementary Table 4. Target sequences for shRNAa)-knockdown experiments

shRNA

Forward (5' → 3')

sh_RUNX1 #1

AGCTTCACTCTGACCATCA

sh_RUNX1 #2

AACCTCGAAGACATCGGCA

sh_BIRC5

ACGTGTGCTGTCCGT

sh_Luc

CGTACGCGGAATACTTCGA

a) shRNA;

short hairpin RNA

Supplementary Table 5. PCR and sequencing primer for Sanger sequence

PCR primers

Forward (5' → 3')

Reverse (3' → 5')

TP53 exon 2–4

CAGGAGTGCTTGGGTTGTGG

CGGCATAGGGGGACGTAAAGA

TP53 exon 5–9

TGCCCTGACTTTCAACTCTG

ACCGAGGACCAACATCGATTG

TP53 exon 10–11

ATGCATGTTGCTTTTGTACCG

TATCCACACGCAGTCTTGT

Sequencing primers

Forward (5' → 3')

TP53 exon 6

CTACTGCTCACCCGGAGG

TP53 exon 7

AGGCCTCCCCTGCTTGCC

Supplementary Table 6. PCR primers used for RT-qPCR

PCR primers

Forward (5' → 3')

Reverse (3' → 5')

RUNX1

AGTCATTTCCTTCGTACCCACA

TGGCATCGTGGACGTCTCTA

RUNX2

GCCTTCAAGGTGGTAGCCC

AAGGTGAAACTCTTGCCTCGTC

BIRC5

CAGATTTGAATCGCGGGACCC

CCAGAGTCTGGCTCGTTCTCAG

p53

ACAGCACATGACGGAGGTTG

CACACGCAAATTTCCTTCCA

p21

CGACTGTGATGCGCTAATGG

CTCCAGTGGTGTCTCGGTGA

Bcl-xL

GGTTCCCTTTCCTTCCATCC

GGAGTCCTGGTCCTTGCATC

PIF1

CCAGGTGATGCTGGTGAAAA

CTGCCTCGAACCCAACTACC

CHK1

TGGGATACCAGCCCCTCATA

GATCCTGGGGTGCCAAGTAA

GAPDH

CATGTTCGTCATGGGGTGAACCA

AGTGATGGCATGGACTGTGGTCAT

Supplementary Table 7. PCR primers used for ChIP

PCR primers

Forward (5' → 3')

Reverse (3' → 5')

BIRC5

CCAGCCTGGCAAACATGG

CTGCAACCTCCTCCCCGC

PIF1

GAACCTGGACAACTTTCAGTCATC

AAACATTGAACCCAGATTACCTGC

...

参考文献をもっと見る

分野

大学

学位論文種類・取得年

言語

A RUNX-targeted gene switch-off approach modulates the BIRC5/PIF1-p21 pathway and reduces glioblastoma growth in mice

概要

この論文で使われている画像

関連論文

Characterization of the Anticancer Activities of Some Natural and Synthetic Compounds: Molecular Targets and Mechanism

HER2 G776S mutation promotes oncogenic potential in colorectal cancer cells when accompanied by loss of APC function

Comprehensive genomics in androgen receptor-dependent castration-resistant prostate cancer identifies an adaptation pathway mediated by opioid receptor kappa 1

Complex roles of the actin-binding protein Girdin/GIV in DNA damage-induced apoptosis of cancer cells

Distinctive roles of syntaxin binding protein 4 and its action target, TP63, in lung squamous cell carcinoma: a theranostic study for the precision medicine

参考文献

分野

大学

学位論文種類・取得年

言語

コピーが完了しました

URLをコピーしました

A RUNX-targeted gene switch-off approach modulates the BIRC5/PIF1-p21 pathway and reduces glioblastoma growth in mice

概要

この論文で使われている画像

関連論文

Characterization of the Anticancer Activities of Some Natural and Synthetic Compounds: Molecular Targets and Mechanism

HER2 G776S mutation promotes oncogenic potential in colorectal cancer cells when accompanied by loss of APC function

Comprehensive genomics in androgen receptor-dependent castration-resistant prostate cancer identifies an adaptation pathway mediated by opioid receptor kappa 1

Complex roles of the actin-binding protein Girdin/GIV in DNA damage-induced apoptosis of cancer cells

Distinctive roles of syntaxin binding protein 4 and its action target, TP63, in lung squamous cell carcinoma: a theranostic study for the precision medicine

参考文献