DIPA-CRISPR is a simple and accessible method for insect gene editing

Belles, X. (2020). Insect Metamorphosis: From Natural History to Regulation of

Development and Evolution (Academic Press).

Brennan, M.D., Weiner, A.J., Goralski, T.J., and Mahowald, A.P. (1982). The

follicle cells are a major site of vitellogenin synthesis in Drosophila melanogaster. Dev. Biol. 89, 225–236. https://doi.org/10.1016/0012-1606(82)

90309-8.

Chaverra-Rodriguez, D., Dalla Benetta, E., Heu, C.C., Rasgon, J.L., Ferree,

P.M., and Akbari, O.S. (2020). Germline mutagenesis of Nasonia vitripennis

through ovarian delivery of CRISPR-Cas9 ribonucleoprotein. Insect Mol.

Biol. 29, 569–577. https://doi.org/10.1111/imb.12663.

OPEN ACCESS

Chaverra-Rodriguez, D., Macias, V.M., Hughes, G.L., Pujhari, S., Suzuki, Y.,

Peterson, D.R., Kim, D., McKeand, S., and Rasgon, J.L. (2018). Targeted delivery of CRISPR-Cas9 ribonucleoprotein into arthropod ovaries for heritable

germline gene editing. Nat. Commun. 9, 3008. https://doi.org/10.1038/

s41467-018-05425-9.

Ciudad, L., Piulachs, M.D., and Belle´s, X. (2006). Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the

Drosophila yolkless mutant. FEBS J. 273, 325–335. https://doi.org/10.1111/j.

1742-4658.2005.05066.x.

Cooper, G.M., and Hausman, R.E. (2007). The Cell: A Molecular Approach

(ASM Press).

Cornwell, P.B. (1968). The Cockroach. Volume 1. A laboratory insect and an

industrial pest (Hutchinson Press).

Daimon, T., Uchibori, M., Nakao, H., Sezutsu, H., and Shinoda, T. (2015).

Knockout silkworms reveal a dispensable role for juvenile hormones in holometabolous life cycle. Proc. Natl. Acad. Sci. U. S. A. 112, E4226–E4235.

https://doi.org/10.1073/pnas.1506645112.

Dermauw, W., Jonckheere, W., Riga, M., Livadaras, I., Vontas, J., and Van

Leeuwen, T. (2020). Targeted mutagenesis using CRISPR-Cas9 in the chelicerate herbivore Tetranychus urticae. Insect Biochem. Mol. Biol. 120,

103347. https://doi.org/10.1016/j.ibmb.2020.103347.

Doudna, J.A., and Charpentier, E. (2014). The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096. https://doi.org/10.1126/

science.1258096.

Gantz, V.M., and Akbari, O.S. (2018). Gene editing technologies and applications for insects. Curr. Opin. Insect Sci. 28, 66–72. https://doi.org/10.1016/j.

cois.2018.05.006.

Gilles, A.F., Schinko, J.B., and Averof, M. (2015). Efficient CRISPR-mediated

gene targeting and transgene replacement in the beetle Tribolium castaneum.

Development 142, 2832–2839. https://doi.org/10.1242/dev.125054.

Grubbs, N., Haas, S., Beeman, R.W., and Lorenzen, M.D. (2015). The ABCs of

eye color in Tribolium castaneum: orthologs of the Drosophila white, scarlet,

and brown genes. Genetics 199, 749–759. https://doi.org/10.1534/genetics.

114.173971.

Harrison, M.C., Jongepier, E., Robertson, H.M., Arning, N., Bitard-Feildel, T.,

Chao, H., Childers, C.P., Dinh, H., Doddapaneni, H., Dugan, S., et al. (2018).

Hemimetabolous genomes reveal molecular basis of termite eusociality. Nat.

Ecol. Evol. 2, 557–566. https://doi.org/10.1038/s41559-017-0459-1.

Heu, C.C., McCullough, F.M., Luan, J., and Rasgon, J.L. (2020). CRISPRCas9-based genome editing in the silverleaf whitefly (Bemisia tabaci). CRISPR

J. 3, 89–96. https://doi.org/10.1089/crispr.2019.0067.

Hill, J.T., Demarest, B.L., Bisgrove, B.W., Su, Y.C., Smith, M., and Yost, H.J.

(2014). Poly peak parser: method and software for identification of unknown

indels using sanger sequencing of polymerase chain reaction products. Dev.

Dyn. 243, 1632–1636. https://doi.org/10.1002/dvdy.24183.

Houseman, J.G., and Morrison, P.E. (1986). Absence of female-specific protein in the hemolymph of stable fly Stomoxys calcitrans (L.)(Diptera: Muscidae).

Arch. Insect Biochem. Physiol. 3, 205–213. https://doi.org/10.1002/arch.

940030210.

Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D., Peterson, R.T., Yeh, J.R., and Joung, J.K. (2013). Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat. Biotechnol. 31, 227–229. https://doi.

org/10.1038/nbt.2501.

€nz-Zeise, F., Lancino, M., and Luschnig, S. (2021). TranIsasti-Sanchez, J., Mu

sient opening of tricellular vertices controls paracellular transport through the

follicle epithelium during Drosophila oogenesis. Dev. Cell 56, 1083–1099.e5.

https://doi.org/10.1016/j.devcel.2021.03.021.

Kindle, H., Ko¨nig, R., and Lanzrein, B. (1988). In vitro uptake of vitellogenin by

follicles of the cockroach Nauphoeta cinerea: comparison of artificial media

with haemolymph media and role of vitellogenin concentration and of juvenile

hormone. J. Insect Physiol. 34, 541–548. https://doi.org/10.1016/00221910(88)90196-5.

Cell Reports Methods 2, 100215, May 23, 2022 7

A Self-archived copy in

Kyoto University Research Information Repository

https://repository.kulib.kyoto-u.ac.jp

ll

OPEN ACCESS

Noah Koller, C., Dhadialla, T.S., and Raikhel, A.S. (1989). Selective endocytosis of vitellogenin by oocytes of the mosquito, Aedes aegypti: an in vitro

study. Insect Biochem. 19, 693–702. https://doi.org/10.1016/0020-1790(89)

90106-6.

Li, A., Sadasivam, M., and Ding, J.L. (2003). Receptor-ligand interaction between vitellogenin receptor (VtgR) and vitellogenin (Vtg), implications on low

density lipoprotein receptor and apolipoprotein B/E. J. Biol. Chem. 278,

2799–2806. https://doi.org/10.1074/jbc.m205067200.

Linz, D.M., Clark-Hachtel, C.M., Borra`s-Castells, F., and Tomoyasu, Y. (2014).

Larval RNA interference in the red flour beetle, Tribolium castaneum. J. Vis.

Exp. 92, e52059. https://doi.org/10.3791/52059.

Lorenzen, M.D., Brown, S.J., Denell, R.E., and Beeman, R.W. (2002). Cloning

and characterization of the Tribolium castaneum eye-color genes encoding

tryptophan oxygenase and kynurenine 3-monooxygenase. Genetics 160,

225–234. https://doi.org/10.1093/genetics/160.1.225.

Macias, V.M., McKeand, S., Chaverra-Rodriguez, D., Hughes, G.L., Fazekas,

A., Pujhari, S., Jasinskiene, N., James, A.A., and Rasgon, J.L. (2020). Cas9mediated gene-editing in the malaria mosquito Anopheles stephensi by

ReMOT Control. G3: Genes Genom. Genet. 10, 1353–1360. https://doi.org/

10.1534/g3.120.401133.

Matthews, B.J., and Vosshall, L.B. (2020). How to turn an organism into a

model organism in 10 ‘easy’ steps. J. Exp. Biol. 223, jeb218198. https://doi.

org/10.1242/jeb.218198.

McLaughlin, J.M., and Bratu, D.P. (2015). Drosophila melanogaster Oogenesis: An Overview (Humana Press).

Meisel, R.P., Delclos, P.J., and Wexler, J.R. (2019). The X chromosome of the

German cockroach, Blattella germanica, is homologous to a fly X chromosome

despite 400 million years divergence. BMC Biol. 17, 100–114. https://doi.org/

10.1186/s12915-019-0721-x.

Misof, B., Liu, S., Meusemann, K., Peters, R.S., Donath, A., Mayer, C., Frandsen, P.B., Ware, J., Flouri, T., Beutel, R.G., et al. (2014). Phylogenomics resolves the timing and pattern of insect evolution. Science 346, 763–767.

https://doi.org/10.1126/science.1257570.

Miura, T., Braendle, C., Shingleton, A., Sisk, G., Kambhampati, S., and Stern,

D.L. (2003). A comparison of parthenogenetic and sexual embryogenesis of

the pea aphid Acyrthosiphon pisum (Hemiptera: aphidoidea). J. Exp. Biol. B:

Mol. Dev. Evol. 295B, 59–81. https://doi.org/10.1002/jez.b.3.

Murakami, Y., Horibe, T., and Kinoshita, M. (2019). Development of an efficient

bioreactor system for delivering foreign proteins secreted from liver into eggs

8 Cell Reports Methods 2, 100215, May 23, 2022

Report

with a vitellogenin signal in medaka Oryzias latipes. Fish. Sci. 85, 677–685.

https://doi.org/10.1007/s12562-019-01320-4.

Parthasarathy, R., Sheng, Z., Sun, Z., and Palli, S.R. (2010). Ecdysteroid regulation of ovarian growth and oocyte maturation in the red flour beetle, Tribolium

castaneum. Insect Biochem. Mol. Biol. 40, 429–439. https://doi.org/10.1016/j.

ibmb.2010.04.002.

Pascual, N., Cerda´, X., Benito, B., Toma´s, J., Piulachs, M., and Belle´s, X.

(1992). Ovarian ecdysteroid levels and basal oo¨cyte development during

maturation in the cockroach Blattella germanica (L.). J. Insect Physiol. 38,

339–348. https://doi.org/10.1016/0022-1910(92)90058-l.

Posnien, N., Schinko, J., Grossmann, D., Shippy, T.D., Konopova, B., and

Bucher, G. (2009). RNAi in the red flour beetle (Tribolium). Cold Spring Harb.

Protoc. 2009, prot5256. https://doi.org/10.1101/pdb.prot5256.

Quan, G.X., Kim, I., Komoto, N., Sezutsu, H., Ote, M., Shimada, T., Kanda, T.,

Mita, K., Kobayashi, M., and Tamura, T. (2002). Characterization of the kynurenine 3-monooxygenase gene corresponding to the white egg 1 mutant in the

silkworm Bombyx mori. Mol. Genet. Genom. 267, 1–9. https://doi.org/10.

1007/s00438-001-0629-2.

Raikhel, A.S., and Dhadialla, T.S. (1992). Accumulation of yolk proteins in insect oocytes. Ann. Rev. Entomol. 37, 217–251. https://doi.org/10.1146/annurev.en.37.010192.001245.

Ren, X., Yang, Z., Xu, J., Sun, J., Mao, D., Hu, Y., Yang, S.J., Qiao, H.H., Wang,

X., Hu, Q., et al. (2014). Enhanced specificity and efficiency of the CRISPR/

Cas9 system with optimized sgRNA parameters in Drosophila. Cell Rep. 9,

1151–1162. https://doi.org/10.1016/j.celrep.2014.09.044.

Row, S., Huang, Y.-C., and Deng, W.-M. (2021). Developmental regulation of

oocyte lipid intake through ‘patent’ follicular epithelium in Drosophila melanogaster. iScience 24, 102275. https://doi.org/10.1016/j.isci.2021.102275.

Shirai, Y., and Daimon, T. (2020). Mutations in cardinal are responsible for the

red-1 and peach eye color mutants of the red flour beetle Tribolium castaneum.

Biochem. Biophys. Res. Commun. 529, 372–378. https://doi.org/10.1016/j.

bbrc.2020.05.214.

Tamura, T., Thibert, C., Royer, C., Kanda, T., Eappen, A., Kamba, M., Komoto,

N., Thomas, J.L., Mauchamp, B., Chavancy, G., et al. (2000). Germline transformation of the silkworm Bombyx mori L. using a piggyBac transposonderived vector. Nat. Biotechnol. 18, 81–84. https://doi.org/10.1038/71978.

Treiblmayr, K., Pascual, N., Piulachs, M.-D., Keller, T., and Belles, X. (2006).

Juvenile hormone titer versus juvenile hormone synthesis in female nymphs

and adults of the German cockroach, Blattella germanica. J. Insect Sci. 6,

1–7. https://doi.org/10.1673/031.006.4301.

A Self-archived copy in

Kyoto University Research Information Repository

https://repository.kulib.kyoto-u.ac.jp

ll

OPEN ACCESS

Report

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Promega

Cat#P1320

Chemicals, peptides, and recombinant proteins

T7 RiboMAX Express Large Scale

RNA Production System

Phenol:chloroform:isoamyl alcohol mixture

Sigma-Aldrich

Cat#77619

Alt-R S.p. Cas9 Nuclease V3

Integrated DNA Technologies

Cat#1081059

Cas9 Protein

Sigma-Aldrich

Cat#CAS9PROT

Cas9 Nuclease protein NLS

FUJIFILM Wako

Cat#316-08651

GenomeCraft Cas9

Fasmac

Cat#GE-005-S

Chloroquine Diphosphate

FUJIFILM Wako

Cat#038-17971

Saponin Quilaja sp.

Sigma-Aldrich

Cat#S4521

KOD FX Neo

TOYOBO

Cat#KFX-201

Experimental models: Organisms/strains

B. germanica wildtype Japanese strain

Sumika Technoservice

N/A

T. castaneum wildtype Okinawa strain

Shirai and Daimon, 2020

N/A

D. melanogaster wildtype Canton S strain

Gift from Christen Mirth

N/A

Oligonucleotides

PCR primers used in this study, see Method Details

This paper

N/A

ssODN (50 - to -30 ) used as a HDR template:

ACCCTTTATCCGAATTTAATGTCACTTGTA

TGGAATTTGTGCGGTCGGCAAATGCCGC

CACTTGTTGTCTGGGGCCCAGGGAACAG

ATGAACCAAGCTTGACCGCGTTTATAGAC

GGGTCGGTTATTTACGGGGTGGAGGAAA

AGACAGTTGGGGCGCTCCGGACGATGTC

AGGGGGTGAACTCGAAATGTTTG

Integrated DNA

Technologies

N/A (Ultramer DNA

Oligonucleotides)

Hwang et al., 2013

Addgene Plasmid #42250

Recombinant DNA

pDR274

Software and algorithms

GraphPad Prism (v.6.0h)

GraphPad

RRID:SCR_002798

Leica Application Suite X (LASX)

Leica Microsystems

https://www.leica-microsystems.com/

Adobe Photoshop

Adobe

RRID:SCR_014199

Femtojet 4i Microinjector

Eppendorf

Cat#5252000021

MultiNA Microchip Electrophoresis System

SHIMADZU

MCE-202

Needle puller

Narishige

PC-100

Other

Borosilicate glass with filament

Sutter Instrument

BF-100-50-10

Stereomicroscope

Leica Microsystems

M165FC

Digital microscope camera

Leica Microsystems

DFC7000T

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Takaaki

Daimon (daimon.takaaki.7a@kyoto-u.ac.jp).

Materials availability

The knockout lines generated in this study is available on reasonable request to the lead contact.

Cell Reports Methods 2, 100215, May 23, 2022 e1

A Self-archived copy in

Kyoto University Research Information Repository

https://repository.kulib.kyoto-u.ac.jp

ll

OPEN ACCESS

Report

Data and code availability

d All data reported in this paper will be shared by the lead contact upon request.

d This study does not report original code.

d Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Insects

A Blattella germanica colony derived from a Japanese population was maintained at 25 ± 1.5 C under a 16 h:8 h light:dark cycle with a

constant supply of solid feed (MF, Oriental Yeast) and water. A Tribolium castaneum (Okinawa strain) colony was maintained on

wheat flour containing 5% (w/w) brewer’s dry yeast at 30 ± 1 C and 50%–70% relative humidity as described previously (Shirai

and Daimon, 2020). The wildtype Drosophila melanogaster strain (Canton S) was reared using a commercial Drosophila diet (Formula

4-24 Instant Drosophila Food, Carolina Biological, Cat#173210).

METHOD DETAILS

Preparation of Cas9-sgRNA RNPs

Single-guide RNAs (sgRNAs) targeting B. germanica cinnabar (GenBank: PSN36199), T. castaneum cardinal (GenPept: XP_008200769),

and D. melanogaster white (GenBank: NM_057439) were synthesized as described previously (Shirai and Daimon, 2020). Briefly, annealed oligo DNA was cloned into the BsaI site of the pDR274 vector (Hwang et al., 2013). After linearization with DraI, the vector

was used as a template for in vitro transcription using the T7 RiboMAX Express Large Scale RNA Production System (Promega,

Cat#P1320). The synthesized sgRNAs were extracted with phenol (pH4–5):chloroform:isoamyl alcohol (125:24:1) (Sigma,

Cat#77619), and then precipitated with isopropanol and dissolved in RNase-free water. For D. melanogaster white, we also purchased

and used chemically synthesized sgRNAs from the Integrated DNA Technologies (IDT) (Alt-R CRISPR-Cas9 sgRNA). Otherwise

stated, commercial Cas9 protein purchased from IDT (Alt-R S.p. Cas9 Nuclease V3, Cat#1081059), which has nuclear localization signals and a C-terminal 6-His tag (further details were not disclosed to the authors), was used in this study. Cas9 protein and sgRNAs were

mixed at a molar ratio of approximately 1:2, and incubated for 10–15 min at room temperature to allow Cas9 RNP formation. In some

experiments, freshly-prepared chloroquine (FUJIFILM Wako, Cat#038-17971) or saponin (Sigma, Cat#S4521) was added as an endosomal escape reagent (EER) (Chaverra-Rodriguez et al., 2018). Concentrations of Cas9 RNPs and EERs in the injection solution were

adjusted with RNase-free water, without adding any other reagents (e.g., buffers or salts). The target sequences of sgRNAs are (5’to -30 ): GGTCTGGCTGTAGTCAAACA for B. germanica cinnabar sgRNA1; TTGGAGGCATGCAAAGCTCC for B. germanica cinnabar

sgRNA2; GGAACAGATGAACCAAGTGA for T. castaneum cardinal sgRNA1 (Shirai and Daimon, 2020); CATTAACCAGGGCT

TCGGGC for D. melanogaster white sgRNA1 (Ren et al., 2014); and AGCGACACATACCGGCGCCC for D. melanogaster white sgRNA2

(Ren et al., 2014).

Adult injection and mutant screening in Blattella germanica

Female adults carrying the ootheca were collected from a stock colony, monitored daily for ootheca drop, and were staged based on

the day after the ootheca drop. The injection was performed using a glass capillary needle equipped with Femtojet 4i (Eppendorf). The

females used for injection were anesthetized on ice. Approximately 4 mL of the Cas9 RNP solution containing 3.3 mg/mL Cas9 (IDT,

Cat#1081059) and 1.3 mg/mL sgRNAs (a mixture of sgRNA1 and sgRNA2, Figure S1A) with or without chloroquine (2 mM) was injected

into the ventral abdomen of the female adults. Injected females were individually reared in containers until the formation of the next

ootheca and hatching of G0 nymphs (nymphs hatched 20–30 days after injection with 20–50 nymphs hatched from each ootheca).

The eye colors of hatched G0 nymphs were examined, and all the nymphs without external phenotypes were subjected to individual

genotyping. B. germanica cinnabar is an autosomal gene, as we found heterozygous males [male = XO and female = XX in

B. germanica (Meisel et al., 2019)].

Genotyping of Blattella germanica

Genomic DNAs were extracted individually as described previously (Daimon et al., 2015). Genomic PCR was conducted using KOD FX

Neo (TOYOBO, Cat#KFX-201). Mutations were screened by analyzing the PCR products using the heteroduplex mobility assay (HMA)

using the MultiNA Microchip Electrophoresis System (MCE-202, Shimadzu). Primer sequences for HMA of B. germanica cinnabar are

(5’- to -30 ): GAAGGCGGATTTGATCATAGGAGC and CAATCACTTACCTCACCATCTTCTG. To determine the nucleotide sequences of

mutant alleles, Sanger sequencing chromatograms were analyzed with Poly Peak Parser program (Hill et al., 2014). Primer sequences for

Sanger sequencing of B. germanica cinnabar are (5’- to -30 ): GGCGCACTTGAGGCAGATATG and TTCCCCTACACTTCAATGCGGG.

Adult injection and mutant screening in Tribolium castaneum

Female adults at selected days after adult emergence, separated from males at the time of injection, were injected with approximately 0.5 mL of the Cas9 RNP solution containing 3.3 mg/mL Cas9 (IDT, Cat#1081059) and 1.3 mg/mL sgRNA, with or without saponin

e2 Cell Reports Methods 2, 100215, May 23, 2022

A Self-archived copy in

Kyoto University Research Information Repository

https://repository.kulib.kyoto-u.ac.jp

ll

Report

OPEN ACCESS

(100 ng/mL), as described previously (Shirai and Daimon, 2020). The injected females were grouped with males in a container with

wheat flour and transferred to a new container every 24 hours to examine the relationship between the day of egg laying and the

gene editing efficiencies in the hatchlings. To screen gene-edited individuals, the eye colors of the G0 insects were examined during

pupal and adult stages. We also examined and compared the performance of Cas9 products from three companies additional to IDT:

Sigma (Cat #CAS9PROT), FUJIFILM Wako (Cat#316-08651), and Fasmac (Cat#GE-005-S), which have a single or multiple nuclear

localization signals, by targeting cardinal under the same condition (i.e., the same stage of injection and concentration of reagents).

As cardinal gene locates on the X chromosome (female = XX, male = XY) (Shirai and Daimon, 2020), mutant phenotypes are not visible

in heterozygous females. As we screened G0 insects based on phenotypes but not on genotypes, the GEF values for T. castaneum

cardinal in this study were most likely underestimated. Primer sequences for Sanger sequencing of T. castaneum cardinal are (5’- to

-30 ): GGCCAAAACCGGGGCGCTTCC and CCGGAAGTTCGTGGGTACAAGCCCG (Shirai and Daimon, 2020).

Gene knock-in experiments in Tribolium castaneum

Female adults at optimized stages (i.e., 4–5 days after adult emergence) were injected as above. Injection solution contained 3.3 mg/mL

Cas9 (IDT, Cat#1081059), 1.3 mg/mL sgRNA (sgRNA1 for cardinal), and ssODNs (1.6 mg/mL). ssODNs were purchased from IDT (Ultramer

DNA Oligonucleotides). Injected females were allowed to lay eggs for two days, and the recovered G0 adults with both eyes whites were

subjected to genotyping. For genotyping, genomic DNAs of G0 adults were individually extracted, and used as a template for PCR. PCR

products were digested with HindIII and analyzed by microchip electrophoresis using the MultiNA Microchip Electrophoresis System

(MCE-202, Shimadzu). Primer sequences for T. castaneum cardinal are (5’- to -30 ): GTCACACATCCGGAGTGCTTTCC and

GAGTTCACCCCCTGACATCGTC. To determine the nucleotide sequences of knock-in alleles, PCR products were subcloned and

subjected to Sanger sequencing.

Adult injection and mutant screening in Drosophila melanogaster

Female adults at selected times after adult emergence, separated from males at the time of injection, were injected with approximately 0.5 mL of the Cas9 RNP solution containing 3.3 mg/mL Cas9 (IDT, Cat#1081059) and 1.3 mg/mL sgRNA (a mixture of sgRNA1

and sgRNA2 for white), with or without chloroquine (0.5 or 2.0 mM). The injected females were grouped with males in a vial and transferred to a new vial every 24 hours. To screen gene-edited individuals, the eye colors of the G0 insects were examined during adult

stages.

QUANTIFICATION AND STATISTICAL ANALYSIS

Data on gene editing efficiency (GEF) of the G0 progenies (Figure S1C) were analyzed with the Mann-Whitney nonparametric U test.

Statistical analyses were performed in the Prism software (Graphpad Software).

Cell Reports Methods 2, 100215, May 23, 2022 e3

...