FIGNL1 AAA+ ATPase remodels RAD51 and DMC1 filaments in pre-meiotic DNA replication and meiotic recombination

1.

2.

3.

4.

5.

Electrophoresis mobility shift assay (EMSA)

Double-stranded DNA substrate was prepared by annealing 5’-Cy5labeled, 40-mer oligo DNA (Oligo 1, Cy5-TAATACAAAATAAGT

AAATGAATAAACAGAGAAAATAAAG, IDT) and its complementary

DNA (Oligo 2, CTTTATTTTCTCTGTTTATTCATTTACTTATTTTGTA

TTA, Fasmac). Oligo 1 was used as an ssDNA substrate. For the assay,

DNA (0.8 μM in bp/nt) was pre-incubated with 1 μM of RAD51 in 10 μl of

the buffer (20 mM HEPES-NaOH pH7.5, 100 ug/ml BSA, 1 mM DTT,

10 mM MgCl2, 2 mM ATP) at 37 °C for 5 min to form RAD51-DNA

complex. Then the indicated concentration of FIGNL1ΔN was added to

the reaction and further incubated at 37 °C for 15 min. In the control

reaction without FIGNL1ΔN, the same volume of dialysis buffer was

Nature Communications | (2023)14:6857

6.

7.

8.

9.

Sonoda, E. et al. Rad51-deficient vertebrate cells accumulate

chromosomal breaks prior to cell death. EMBO J. 17,

598–608 (1998).

Tashiro, S., Walter, J., Shinohara, A., Kamada, N. & Cremer, T. Rad51

accumulation at sites of DNA damage and in postreplicative chromatin. J. Cell Biol. 150, 283–291 (2000).

Schlacher, K., Wu, H. & Jasin, M. A distinct replication fork protection pathway connects Fanconi anemia tumor suppressors to

RAD51-BRCA1/2. Cancer Cell 22, 106–116 (2012).

Ogawa, T., Yu, X., Shinohara, A. & Egelman, E. H. Similarity of the

yeast RAD51 filament to the bacterial RecA filament. Science 259,

1896–1899 (1993).

Shinohara, A., Ogawa, H. & Ogawa, T. Rad51 protein involved in

repair and recombination in S. cerevisiae is a RecA-like protein. Cell

69, 457–470 (1992).

Jensen, R. B., Carreira, A. & Kowalczykowski, S. C. Purified human

BRCA2 stimulates RAD51-mediated recombination. Nature 467,

678–683 (2010).

Zhao, W. et al. BRCA1-BARD1 promotes RAD51-mediated homologous DNA pairing. Nature 550, 360–365 (2017).

Shinohara, A. & Ogawa, T. Stimulation by Rad52 of yeast Rad51mediated recombination. Nature 391, 404–407 (1998).

Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H. & Iwasaki, H. Two different Swi5-containing protein complexes are

involved in mating-type switching and recombination repair in fission yeast. Proc. Natl Acad. Sci. USA 100, 15770–15775 (2003).

16

Article

10. Masson, J. Y. et al. Identification and purification of two distinct

complexes containing the five RAD51 paralogs. Genes Dev. 15,

3296–3307 (2001).

11. Abreu, C. M. et al. Shu complex SWS1-SWSAP1 promotes early

steps in mouse meiotic recombination. Nat. Commun. 9,

3961 (2018).

12. Liu, T., Wan, L., Wu, Y., Chen, J. & Huang, J. hSWS1.SWSAP1 is an

evolutionarily conserved complex required for efficient homologous recombination repair. J. Biol. Chem. 286,

41758–41766 (2011).

13. Tanaka, K., Kagawa, W., Kinebuchi, T., Kurumizaka, H. & Miyagawa,

K. Human Rad54B is a double-stranded DNA-dependent ATPase

and has biochemical properties different from its structural

homolog in yeast, Tid1/Rdh54. Nucleic Acids Res. 30,

1346–1353 (2002).

14. Wiese, C. et al. Promotion of homologous recombination and

genomic stability by RAD51AP1 via RAD51 recombinase enhancement. Mol. Cell 28, 482–490 (2007).

15. Bugreev, D. V., Yu, X., Egelman, E. H. & Mazin, A. V. Novel pro- and

anti-recombination activities of the Bloom’s syndrome helicase.

Genes Dev. 21, 3085–3094 (2007).

16. Sommers, J. A. et al. FANCJ uses its motor ATPase to destabilize

protein-DNA complexes, unwind triplexes, and inhibit RAD51 strand

exchange. J. Biol. Chem. 284, 7505–7517 (2009).

17. Schwendener, S. et al. Physical interaction of RECQ5 helicase with

RAD51 facilitates its anti-recombinase activity. J. Biol. Chem. 285,

15739–15745 (2010).

18. Simandlova, J. et al. FBH1 helicase disrupts RAD51 filaments in vitro

and modulates homologous recombination in mammalian cells. J.

Biol. Chem. 288, 34168–34180 (2013).

19. Moldovan, G. L. et al. Inhibition of homologous recombination by

the PCNA-interacting protein PARI. Mol. Cell 45, 75–86 (2012).

20. Croteau, D. L., Popuri, V., Opresko, P. L. & Bohr, V. A. Human RecQ

helicases in DNA repair, recombination, and replication. Annu Rev.

Biochem 83, 519–552 (2014).

21. Heyer, W. D., Li, X., Rolfsmeier, M. & Zhang, X. P. Rad54: the Swiss

Army knife of homologous recombination? Nucleic Acids Res. 34,

4115–4125 (2006).

22. Scully, R., Panday, A., Elango, R. & Willis, N. A. DNA double-strand

break repair-pathway choice in somatic mammalian cells. Nat. Rev.

Mol. Cell Biol. 20, 698–714 (2019).

23. Ito, M. & Shinohara, A. Chromosome architecture and homologous

recombination in meiosis. Front Cell Dev. Biol. 10, 1097446 (2022).

24. Bishop, D. K., Park, D., Xu, L. & Kleckner, N. DMC1: a meiosis-specific

yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell 69,

439–456 (1992).

25. Brown, M. S. & Bishop, D. K. DNA strand exchange and RecA

homologs in meiosis. Cold Spring Harb. Perspect. Biol. 7,

a016659 (2014).

26. Lim, D. S. & Hasty, P. A mutation in mouse rad51 results in an early

embryonic lethal that is suppressed by a mutation in p53. Mol. Cell

Biol. 16, 7133–7143 (1996).

27. Prakash, R. et al. XRCC3 loss leads to midgestational embryonic

lethality in mice. DNA Repair 108, 103227 (2021).

28. Tsuzuki, T. et al. Targeted disruption of the Rad51 gene leads to

lethality in embryonic mice. Proc. Natl Acad. Sci. USA 93,

6236–6240 (1996).

29. Matsuzaki, K., Kondo, S., Ishikawa, T. & Shinohara, A. Human

RAD51 paralogue SWSAP1 fosters RAD51 filament by regulating the

anti-recombinase FIGNL1 AAA+ ATPase. Nat. Commun. 10,

1407 (2019).

30. Prakash, R. et al. Distinct pathways of homologous recombination

controlled by the SWS1-SWSAP1-SPIDR complex. Nat. Commun. 12,

4255 (2021).

Nature Communications | (2023)14:6857

https://doi.org/10.1038/s41467-023-42576-w

31. Chester, N., Kuo, F., Kozak, C., O’Hara, C. D. & Leder, P. Stagespecific apoptosis, developmental delay, and embryonic lethality in

mice homozygous for a targeted disruption in the murine Bloom’s

syndrome gene. Genes Dev. 12, 3382–3393 (1998).

32. Wesoly, J. et al. Differential contributions of mammalian Rad54

paralogs to recombination, DNA damage repair, and meiosis. Mol.

Cell Biol. 26, 976–989 (2006).

33. McNally, F. J. & Roll-Mecak, A. Microtubule-severing enzymes: From

cellular functions to molecular mechanism. J. Cell Biol. 217,

4057–4069 (2018).

34. Yuan, J. & Chen, J. FIGNL1-containing protein complex is required

for efficient homologous recombination repair. Proc. Natl Acad. Sci.

USA 110, 10640–10645 (2013).

35. Fernandes, J. B. et al. FIGL1 and its novel partner FLIP form a conserved complex that regulates homologous recombination. PLoS

Genet. 14, e1007317 (2018).

36. Girard, C. et al. AAA-ATPase FIDGETIN-LIKE 1 and helicase FANCM

antagonize meiotic crossovers by distinct mechanisms. PLoS

Genet. 11, e1005369 (2015).

37. Yang, S. et al. FIGNL1 inhibits non-homologous chromosome

association and crossover formation. Front. Plant Sci. 13,

945893 (2022).

38. Kumar, R., Duhamel, M., Coutant, E., Ben-Nahia, E. & Mercier, R.

Antagonism between BRCA2 and FIGL1 regulates homologous

recombination. Nucleic Acids Res. 47, 5170–5180 (2019).

39. Zainu, A. et al. The FIGNL1-FIRRM complex is required to complete

meiotic recombination in the mouse and prevents massive DNA

damage-independent RAD51 and DMC1 loading. Preprint at bioRxiv

https://doi.org/10.1101/2023.05.17.541096 (2023).

40. Sharan, S. K. et al. Embryonic lethality and radiation hypersensitivity

mediated by Rad51 in mice lacking Brca2. Nature 386,

804–810 (1997).

41. Sadate-Ngatchou, P. I., Payne, C. J., Dearth, A. T. & Braun, R. E. Cre

recombinase activity specific to postnatal, premeiotic male germ

cells in transgenic mice. Genesis 46, 738–742 (2008).

42. Yuan, L., Brundell, E. & Hoog, C. Expression of the meiosis-specific

synaptonemal complex protein 1 in a heterologous system results in

the formation of large protein structures. Exp. Cell Res. 229,

272–275 (1996).

43. Yuan, L. et al. The murine SCP3 gene is required for synaptonemal

complex assembly, chromosome synapsis, and male fertility. Mol.

Cell 5, 73–83 (2000).

44. Mahadevaiah, S. K. et al. Recombinational DNA double-strand

breaks in mice precede synapsis. Nat. Genet. 27, 271–276 (2001).

45. Luo, M. et al. MEIOB exhibits single-stranded DNA-binding and

exonuclease activities and is essential for meiotic recombination.

Nat. Commun. 4, 2788 (2013).

46. Yoshida, K. et al. The mouse RecA-like gene Dmc1 is required for

homologous chromosome synapsis during meiosis. Mol. Cell 1,

707–718 (1998).

47. Shi, B. et al. Dual functions for the ssDNA-binding protein RPA in

meiotic recombination. PLoS Genet. 15, e1007952 (2019).

48. Moens, P. B. et al. The time course and chromosomal localization of

recombination-related proteins at meiosis in the mouse are compatible with models that can resolve the early DNA-DNA interactions without reciprocal recombination. J. Cell Sci. 115,

1611–1622 (2002).

49. Baker, S. M. et al. Involvement of mouse Mlh1 in DNA mismatch

repair and meiotic crossing over. Nat. Genet. 13, 336–342 (1996).

50. Ashley, T. et al. Dynamic changes in Rad51 distribution on chromatin during meiosis in male and female vertebrates. Chromosoma

104, 19–28 (1995).

51. Ikeya, T., Shinohara, A., Sato, S., Tabata, S. & Ogawa, T. Localization

of mouse Rad51 and Lim15 proteins on meiotic chromosomes at late

stages of prophase 1. Genes Cells 1, 379–389 (1996).

17

Article

52. Tarsounas, M., Morita, T., Pearlman, R. E. & Moens, P. B. RAD51 and

DMC1 form mixed complexes associated with mouse meiotic

chromosome cores and synaptonemal complexes. J. Cell Biol. 147,

207–220 (1999).

53. Baudat, F., Manova, K., Yuen, J. P., Jasin, M. & Keeney, S. Chromosome synapsis defects and sexually dimorphic meiotic progression

in mice lacking Spo11. Mol. Cell 6, 989–998 (2000).

54. Romanienko, P. J. & Camerini-Otero, R. D. The mouse Spo11

gene is required for meiotic chromosome synapsis. Mol. Cell 6,

975–987 (2000).

55. Zhang, Q. et al. The FLIP-FIGNL1 complex regulates the dissociation

of RAD51/DMC1 in homologous recombination and replication fork

restart. Nucleic Acids Res. 51, 8606–8622 (2023).

56. Hinch, A. G. et al. The Configuration of RPA, RAD51, and DMC1

Binding in Meiosis Reveals the Nature of Critical Recombination

Intermediates. Mol. Cell 79, 689–701.e610 (2020).

57. Khil, P. P., Smagulova, F., Brick, K. M., Camerini-Otero, R. D. & Petukhova, G. V. Sensitive mapping of recombination hotspots using

sequencing-based detection of ssDNA. Genome Res. 22,

957–965 (2012).

58. Smagulova, F. et al. Genome-wide analysis reveals novel molecular

features of mouse recombination hotspots. Nature 472, 375–378

(2011).

59. Li, X. & Heyer, W. D. RAD54 controls access to the invading 3’-OH

end after RAD51-mediated DNA strand invasion in homologous

recombination in Saccharomyces cerevisiae. Nucleic Acids Res. 37,

638–646 (2009).

60. Li, X., Stith, C. M., Burgers, P. M. & Heyer, W. D. PCNA is required for

initiation of recombination-associated DNA synthesis by DNA

polymerase delta. Mol. Cell 36, 704–713 (2009).

61. Bugreev, D. V. et al. The resistance of DMC1 D-loops to dissociation

may account for the DMC1 requirement in meiosis. Nat. Struct. Mol.

Biol. 18, 56–60 (2011).

62. Kneitz, B. et al. MutS homolog 4 localization to meiotic chromosomes is required for chromosome pairing during meiosis in male

and female mice. Genes Dev. 14, 1085–1097 (2000).

63. Roig, I. et al. Mouse TRIP13/PCH2 is required for recombination and

normal higher-order chromosome structure during meiosis. PLoS

Genet. 6, e1001062 (2010).

64. Benson, F. E., Stasiak, A. & West, S. C. Purification and characterization of the human Rad51 protein, an analogue of E. coli RecA.

EMBO J. 13, 5764–5771 (1994).

65. Dupaigne, P. et al. Rad51 polymerization reveals a new chromatin

remodeling mechanism. PLoS ONE 3, e3643 (2008).

66. Senavirathne, G., Mahto, S. K., Hanne, J., O’Brian, D. & Fishel, R.

Dynamic unwrapping of nucleosomes by HsRAD51 that includes

sliding and rotational motion of histone octamers. Nucleic Acids

Res. 45, 685–698 (2017).

67. Holzen, T. M., Shah, P. P., Olivares, H. A. & Bishop, D. K. Tid1/Rdh54

promotes dissociation of Dmc1 from nonrecombinogenic sites on

meiotic chromatin. Genes Dev. 20, 2593–2604 (2006).

68. Shah, P. P. et al. Swi2/Snf2-related translocases prevent accumulation of toxic Rad51 complexes during mitotic growth. Mol. Cell 39,

862–872 (2010).

69. Mason, J. M. et al. RAD54 family translocases counter genotoxic

effects of RAD51 in human tumor cells. Nucleic Acids Res. 43,

3180–3196 (2015).

70. Kiianitsa, K., Solinger, J. A. & Heyer, W. D. Rad54 protein exerts

diverse modes of ATPase activity on duplex DNA partially and fully

covered with Rad51 protein. J. Biol. Chem. 277,

46205–46215 (2002).

71. Solinger, J. A., Kiianitsa, K. & Heyer, W. D. Rad54, a Swi2/Snf2-like

recombinational repair protein, disassembles Rad51:dsDNA filaments. Mol. Cell 10, 1175–1188 (2002).

Nature Communications | (2023)14:6857

https://doi.org/10.1038/s41467-023-42576-w

72. Tokuhiro, K. et al. Calreticulin is required for development of the

cumulus oocyte complex and female fertility. Sci. Rep. 5,

14254 (2015).

73. Peters, A. H., Plug, A. W., van Vugt, M. J. & de Boer, P. A dryingdown technique for the spreading of mammalian meiocytes

from the male and female germline. Chromosome Res. 5, 66–68

(1997).

74. Brick, K., Pratto, F., Sun, C. Y., Camerini-Otero, R. D. & Petukhova, G.

Analysis of meiotic double-strand break initiation in mammals.

Methods Enzymol. 601, 391–418 (2018).

75. Ramirez, F. et al. deepTools2: a next generation web server for

deep-sequencing data analysis. Nucleic Acids Res. 44,

W160–W165 (2016).

76. Matsuo, Y., Sakane, I., Takizawa, Y., Takahashi, M. & Kurumizaka, H.

Roles of the human Rad51 L1 and L2 loops in DNA binding. FEBS J.

273, 3148–3159 (2006).

77. Lange, J. et al. The landscape of mouse meiotic double-strand

break formation, processing, and repair. Cell 167,

695–708.e616 (2016).

78. Boekhout, M. et al. REC114 partner ANKRD31 controls number,

timing, and location of meiotic DNA breaks. Mol. Cell 74, 1053–1068

e1058 (2019).

Acknowledgements

We thank Drs. F. Baudat and B. de Massy for sharing unpublished results.

We acknowledge Drs. F. Pratto and V. Jayakumar for SSDS analysis. We

are grateful to Ms. S. Kondo for the generation of anti-SYCP3. We

acknowledge Drs. S. Keeney, M. Jasin, Y. Fujiwara, and K. Ishiguro for

Spo11 mice and Dr. H. Kurumizaka for the RAD51 expression plasmid. We

are also indebted to members of the Shinohara lab, particularly Ms. S.

Aoyama, A. Maeda, C. Watanabe, M. Yasumura, and S. Hashimoto for

technical assitance. This work was supported by JSPS KAKENHI Grant

Numbers; 19H00981 to A.S., 20K15716 and 16H06279 (PAGS) to M.I., and

19H03157 to A.F.

Author contributions

M.I. and A.S. conceived and designed the experiments. M.I. performed

all experiments on mouse meiosis. M.I., Y.F., and A.T. analyzed SSDS

data. A.F. performed biochemical experiments. K.M. set up Fignl1 mice.

M.I. and A.S. analyzed the data. A.S. prepared the original draft and

wrote the manuscript with help from M.I.

Competing interests

The authors declare no competing interests.

Additional information

Supplementary information The online version contains

supplementary material available at

https://doi.org/10.1038/s41467-023-42576-w.

Correspondence and requests for materials should be addressed to

Masaru Ito or Akira Shinohara.

Peer review information Nature Communications thanks Gabriel Livera,

P. Jeremy Wang and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Reprints and permissions information is available at

http://www.nature.com/reprints

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

18

Article

https://doi.org/10.1038/s41467-023-42576-w

Open Access This article is licensed under a Creative Commons

Attribution 4.0 International License, which permits use, sharing,

adaptation, distribution and reproduction in any medium or format, as

long as you give appropriate credit to the original author(s) and the

source, provide a link to the Creative Commons licence, and indicate if

changes were made. The images or other third party material in this

article are included in the article’s Creative Commons licence, unless

indicated otherwise in a credit line to the material. If material is not

included in the article’s Creative Commons licence and your intended

use is not permitted by statutory regulation or exceeds the permitted

use, you will need to obtain permission directly from the copyright

holder. To view a copy of this licence, visit http://creativecommons.org/

licenses/by/4.0/.

© The Author(s) 2023

Nature Communications | (2023)14:6857

19

...